Incidental Mutation 'R1426:Vmn1r194'
ID162257
Institutional Source Beutler Lab
Gene Symbol Vmn1r194
Ensembl Gene ENSMUSG00000069297
Gene Namevomeronasal 1 receptor 194
SynonymsGm11294
MMRRC Submission 039482-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.068) question?
Stock #R1426 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location22244215-22245105 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 22245066 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 284 (F284L)
Ref Sequence ENSEMBL: ENSMUSP00000089331 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000091737]
Predicted Effect probably damaging
Transcript: ENSMUST00000091737
AA Change: F284L

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000089331
Gene: ENSMUSG00000069297
AA Change: F284L

DomainStartEndE-ValueType
Pfam:V1R 35 296 3.4e-37 PFAM
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.7%
  • 10x: 94.3%
  • 20x: 86.1%
Validation Efficiency 100% (40/40)
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc10 A T 17: 46,324,435 V214E probably damaging Het
Adh1 A G 3: 138,286,795 D224G probably damaging Het
Arhgap28 C A 17: 67,857,464 Q554H probably damaging Het
Atp8a2 T C 14: 59,860,270 K770E probably benign Het
Brat1 G A 5: 140,718,013 V674I probably benign Het
Brd2 ATCTTCTTC ATCTTC 17: 34,114,007 probably benign Het
Ccdc162 T C 10: 41,553,182 D438G possibly damaging Het
Cyp4x1 T A 4: 115,112,791 probably benign Het
Dip2a T C 10: 76,279,820 probably benign Het
Eif2s1 A G 12: 78,881,168 D206G probably benign Het
Elovl7 T A 13: 108,282,494 I220N possibly damaging Het
Gsto1 A G 19: 47,857,942 E76G probably damaging Het
Hspa14 A T 2: 3,508,821 W12R probably damaging Het
L3mbtl2 T A 15: 81,676,317 C260S possibly damaging Het
Lama3 G T 18: 12,481,098 probably null Het
Lrrc34 T A 3: 30,643,579 probably benign Het
Lrrc45 A T 11: 120,720,013 Q525L probably benign Het
Lss T C 10: 76,536,303 I164T probably damaging Het
Myh11 T A 16: 14,205,931 K1527* probably null Het
Naip2 T C 13: 100,161,854 E558G probably benign Het
Naip2 C T 13: 100,161,860 G556D probably benign Het
Ncoa1 T A 12: 4,270,737 probably benign Het
Olfr262 G T 19: 12,241,182 Q160K possibly damaging Het
Olfr768 A T 10: 129,093,690 C95S probably damaging Het
Pafah1b3 T C 7: 25,297,135 E41G possibly damaging Het
Pnmal1 C T 7: 16,960,984 P255S possibly damaging Het
Prkar2b A T 12: 31,962,988 probably benign Het
Rbck1 A T 2: 152,327,241 probably benign Het
Rcor2 A G 19: 7,271,030 S137G possibly damaging Het
Slc25a48 T A 13: 56,448,991 probably benign Het
Slc7a4 A G 16: 17,573,944 probably null Het
Tert T C 13: 73,642,353 probably benign Het
Traf7 A T 17: 24,511,681 I344N probably damaging Het
Xpc A G 6: 91,493,238 M699T probably damaging Het
Zbtb5 T C 4: 44,993,968 H472R possibly damaging Het
Zfp786 A G 6: 47,825,079 V88A probably benign Het
Zkscan7 T C 9: 122,895,163 I399T probably benign Het
Zyg11b G A 4: 108,250,812 R466C probably damaging Het
Other mutations in Vmn1r194
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01890:Vmn1r194 APN 13 22244606 missense probably benign 0.01
IGL02140:Vmn1r194 APN 13 22244536 missense probably benign 0.08
R0066:Vmn1r194 UTSW 13 22244471 missense probably benign 0.33
R0066:Vmn1r194 UTSW 13 22244471 missense probably benign 0.33
R0109:Vmn1r194 UTSW 13 22245047 missense probably damaging 1.00
R0109:Vmn1r194 UTSW 13 22245047 missense probably damaging 1.00
R1276:Vmn1r194 UTSW 13 22244861 missense probably damaging 1.00
R1620:Vmn1r194 UTSW 13 22244963 missense probably damaging 1.00
R4593:Vmn1r194 UTSW 13 22244291 missense possibly damaging 0.60
R4844:Vmn1r194 UTSW 13 22245053 missense probably benign 0.02
R5011:Vmn1r194 UTSW 13 22244888 missense probably benign 0.00
R5110:Vmn1r194 UTSW 13 22245000 missense probably benign 0.07
R5588:Vmn1r194 UTSW 13 22244342 missense possibly damaging 0.75
R5810:Vmn1r194 UTSW 13 22244427 nonsense probably null
R6648:Vmn1r194 UTSW 13 22244524 missense probably benign 0.11
R7660:Vmn1r194 UTSW 13 22244597 missense not run
R7663:Vmn1r194 UTSW 13 22244741 missense not run
Predicted Primers PCR Primer
(F):5'- AGCATCACAAGCGTGTCCTCTACC -3'
(R):5'- GCCCAAGACCTGGGCTATAAAGTG -3'

Sequencing Primer
(F):5'- GTAAATACTTTCAGCCCAGAGATCAG -3'
(R):5'- CCTGGGCTATAAAGTGGCATC -3'
Posted On2014-03-14