Incidental Mutation 'R1426:L3mbtl2'
Institutional Source Beutler Lab
Gene Symbol L3mbtl2
Ensembl Gene ENSMUSG00000022394
Gene NameL3MBTL2 polycomb repressive complex 1 subunit
Synonymsm4mbt, 4732493N06Rik
MMRRC Submission 039482-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1426 (G1)
Quality Score202
Status Validated
Chromosomal Location81663889-81688315 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 81676317 bp
Amino Acid Change Cysteine to Serine at position 260 (C260S)
Ref Sequence ENSEMBL: ENSMUSP00000155456 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023029] [ENSMUST00000172568] [ENSMUST00000172748] [ENSMUST00000173598] [ENSMUST00000174229]
Predicted Effect possibly damaging
Transcript: ENSMUST00000023029
AA Change: C260S

PolyPhen 2 Score 0.722 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000023029
Gene: ENSMUSG00000022394
AA Change: C260S

low complexity region 8 21 N/A INTRINSIC
low complexity region 35 57 N/A INTRINSIC
PDB:2W0T|A 82 110 6e-14 PDB
low complexity region 111 126 N/A INTRINSIC
MBT 179 283 3.8e-26 SMART
MBT 291 391 9.68e-42 SMART
MBT 402 500 6.87e-24 SMART
MBT 508 604 2.57e-55 SMART
low complexity region 613 632 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000172568
AA Change: C260S

PolyPhen 2 Score 0.951 (Sensitivity: 0.79; Specificity: 0.95)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172604
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172620
Predicted Effect possibly damaging
Transcript: ENSMUST00000172748
AA Change: C260S

PolyPhen 2 Score 0.839 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000134333
Gene: ENSMUSG00000022394
AA Change: C260S

low complexity region 8 21 N/A INTRINSIC
low complexity region 35 57 N/A INTRINSIC
PDB:2W0T|A 82 110 1e-13 PDB
low complexity region 111 126 N/A INTRINSIC
MBT 179 283 3.8e-26 SMART
MBT 291 391 9.68e-42 SMART
MBT 402 500 6.87e-24 SMART
MBT 508 604 2.57e-55 SMART
low complexity region 613 632 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000173598
SMART Domains Protein: ENSMUSP00000133834
Gene: ENSMUSG00000063765

LRR 5 28 1.08e-1 SMART
LRR 30 52 6.23e1 SMART
LRR 53 76 9.48e0 SMART
LRR 78 100 6.96e0 SMART
LRR 102 124 1.14e0 SMART
LRR_TYP 125 148 7.09e-6 SMART
LRR 151 173 3.76e1 SMART
LRR 174 199 6.59e1 SMART
LRRCT 208 256 2.87e-11 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173607
Predicted Effect possibly damaging
Transcript: ENSMUST00000174229
AA Change: C260S

PolyPhen 2 Score 0.854 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000133967
Gene: ENSMUSG00000022394
AA Change: C260S

low complexity region 8 21 N/A INTRINSIC
low complexity region 35 57 N/A INTRINSIC
PDB:2W0T|A 82 110 8e-14 PDB
low complexity region 111 126 N/A INTRINSIC
MBT 179 283 3.8e-26 SMART
MBT 291 391 9.68e-42 SMART
MBT 402 500 6.87e-24 SMART
MBT 508 604 2.57e-55 SMART
low complexity region 613 632 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174274
Predicted Effect unknown
Transcript: ENSMUST00000174497
AA Change: C57S
SMART Domains Protein: ENSMUSP00000133549
Gene: ENSMUSG00000022394
AA Change: C57S

Pfam:MBT 12 85 1.1e-21 PFAM
Meta Mutation Damage Score 0.7730 question?
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.7%
  • 10x: 94.3%
  • 20x: 86.1%
Validation Efficiency 100% (40/40)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit failure of the inner cell mass to form a normal primitive ectoderm capable of gastrulation leading to abnormal embryo development, embryonic growth arrest, and lethality during organogenesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc10 A T 17: 46,324,435 V214E probably damaging Het
Adh1 A G 3: 138,286,795 D224G probably damaging Het
Arhgap28 C A 17: 67,857,464 Q554H probably damaging Het
Atp8a2 T C 14: 59,860,270 K770E probably benign Het
Brat1 G A 5: 140,718,013 V674I probably benign Het
Brd2 ATCTTCTTC ATCTTC 17: 34,114,007 probably benign Het
Ccdc162 T C 10: 41,553,182 D438G possibly damaging Het
Cyp4x1 T A 4: 115,112,791 probably benign Het
Dip2a T C 10: 76,279,820 probably benign Het
Eif2s1 A G 12: 78,881,168 D206G probably benign Het
Elovl7 T A 13: 108,282,494 I220N possibly damaging Het
Gsto1 A G 19: 47,857,942 E76G probably damaging Het
Hspa14 A T 2: 3,508,821 W12R probably damaging Het
Lama3 G T 18: 12,481,098 probably null Het
Lrrc34 T A 3: 30,643,579 probably benign Het
Lrrc45 A T 11: 120,720,013 Q525L probably benign Het
Lss T C 10: 76,536,303 I164T probably damaging Het
Myh11 T A 16: 14,205,931 K1527* probably null Het
Naip2 T C 13: 100,161,854 E558G probably benign Het
Naip2 C T 13: 100,161,860 G556D probably benign Het
Ncoa1 T A 12: 4,270,737 probably benign Het
Olfr262 G T 19: 12,241,182 Q160K possibly damaging Het
Olfr768 A T 10: 129,093,690 C95S probably damaging Het
Pafah1b3 T C 7: 25,297,135 E41G possibly damaging Het
Pnmal1 C T 7: 16,960,984 P255S possibly damaging Het
Prkar2b A T 12: 31,962,988 probably benign Het
Rbck1 A T 2: 152,327,241 probably benign Het
Rcor2 A G 19: 7,271,030 S137G possibly damaging Het
Slc25a48 T A 13: 56,448,991 probably benign Het
Slc7a4 A G 16: 17,573,944 probably null Het
Tert T C 13: 73,642,353 probably benign Het
Traf7 A T 17: 24,511,681 I344N probably damaging Het
Vmn1r194 T A 13: 22,245,066 F284L probably damaging Het
Xpc A G 6: 91,493,238 M699T probably damaging Het
Zbtb5 T C 4: 44,993,968 H472R possibly damaging Het
Zfp786 A G 6: 47,825,079 V88A probably benign Het
Zkscan7 T C 9: 122,895,163 I399T probably benign Het
Zyg11b G A 4: 108,250,812 R466C probably damaging Het
Other mutations in L3mbtl2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01111:L3mbtl2 APN 15 81684898 missense possibly damaging 0.89
IGL01380:L3mbtl2 APN 15 81671125 missense possibly damaging 0.75
IGL01479:L3mbtl2 APN 15 81676392 missense probably benign 0.05
IGL02943:L3mbtl2 APN 15 81686255 missense possibly damaging 0.56
IGL03406:L3mbtl2 APN 15 81681993 missense probably damaging 1.00
PIT4431001:L3mbtl2 UTSW 15 81676307 missense probably benign 0.32
R0393:L3mbtl2 UTSW 15 81668741 missense probably damaging 1.00
R0394:L3mbtl2 UTSW 15 81668741 missense probably damaging 1.00
R0449:L3mbtl2 UTSW 15 81668741 missense probably damaging 1.00
R0565:L3mbtl2 UTSW 15 81684286 splice site probably benign
R1263:L3mbtl2 UTSW 15 81682968 missense probably benign 0.00
R1542:L3mbtl2 UTSW 15 81682151 missense probably null 0.45
R1556:L3mbtl2 UTSW 15 81682002 missense probably benign 0.23
R1922:L3mbtl2 UTSW 15 81675621 missense probably damaging 1.00
R2135:L3mbtl2 UTSW 15 81682014 missense possibly damaging 0.94
R2237:L3mbtl2 UTSW 15 81684330 missense probably benign
R4112:L3mbtl2 UTSW 15 81681969 missense possibly damaging 0.90
R4577:L3mbtl2 UTSW 15 81686285 missense probably benign
R4583:L3mbtl2 UTSW 15 81684906 missense probably damaging 1.00
R4779:L3mbtl2 UTSW 15 81682612 missense probably benign
R4787:L3mbtl2 UTSW 15 81663974 utr 5 prime probably benign
R5448:L3mbtl2 UTSW 15 81684333 missense possibly damaging 0.93
R5776:L3mbtl2 UTSW 15 81684871 missense probably damaging 1.00
R6019:L3mbtl2 UTSW 15 81686942 missense probably benign 0.00
R6058:L3mbtl2 UTSW 15 81667354 missense probably benign
R6259:L3mbtl2 UTSW 15 81681927 missense probably damaging 1.00
R7178:L3mbtl2 UTSW 15 81671074 missense probably benign 0.00
R7311:L3mbtl2 UTSW 15 81667387 missense possibly damaging 0.76
Predicted Primers PCR Primer

Sequencing Primer
(R):5'- agacattcactactcaggcac -3'
Posted On2014-03-14