Mutagenetix > Incidental Mutations

Incidental Mutation 'R1426:Myh11'

162262

Institutional Source

Beutler Lab

Gene Symbol

Myh11

Ensembl Gene

ENSMUSG00000018830

Gene Name

myosin, heavy polypeptide 11, smooth muscle

Synonyms

smMHC, SM1, SM2

MMRRC Submission

039482-MU

Accession Numbers

Genbank: NM_013607, NM_001161775

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R1426 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

14194535-14291372 bp(-) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

T to A at 14205931 bp

Zygosity

Heterozygous

Amino Acid Change

Lysine to Stop codon at position 1527 (K1527*)

Ref Sequence

ENSEMBL: ENSMUSP00000156021 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000090287] [ENSMUST00000230397] [ENSMUST00000231567]

Predicted Effect

probably null
Transcript: ENSMUST00000090287
AA Change: K1520*

SMART Domains

Protein: ENSMUSP00000087756
Gene: ENSMUSG00000018830
AA Change: K1520*

Domain	Start	End	E-Value	Type
Pfam:Myosin_N	33	73	1e-15	PFAM
MYSc	79	784	N/A	SMART
IQ	785	807	1.09e-2	SMART
Pfam:Myosin_tail_1	848	1928	N/A	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000230397
AA Change: K1520*

Predicted Effect

probably null
Transcript: ENSMUST00000231567
AA Change: K1527*

Meta Mutation Damage Score

0.686

Coding Region Coverage

1x: 98.8%
3x: 97.7%
10x: 94.3%
20x: 86.1%

Validation Efficiency

100% (40/40)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a smooth muscle myosin belonging to the myosin heavy chain family. The gene product is a subunit of a hexameric protein that consists of two heavy chain subunits and two pairs of non-identical light chain subunits. It functions as a major contractile protein, converting chemical energy into mechanical energy through the hydrolysis of ATP. The gene encoding a human ortholog of rat NUDE1 is transcribed from the reverse strand of this gene, and its 3' end overlaps with that of the latter. The pericentric inversion of chromosome 16 [inv(16)(p13q22)] produces a chimeric transcript that encodes a protein consisting of the first 165 residues from the N terminus of core-binding factor beta in a fusion with the C-terminal portion of the smooth muscle myosin heavy chain. This chromosomal rearrangement is associated with acute myeloid leukemia of the M4Eo subtype. Alternative splicing generates isoforms that are differentially expressed, with ratios changing during muscle cell maturation. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice have impaired smooth muscle contractility. They are incapable of urinating, exhibit dilative cardiomyopathy, are growth retarded, and die within 3 days of birth. [provided by MGI curators]

Allele List at MGI

All alleles(4) : Targeted, knock-out(4)

Other mutations in this stock

Total: 38 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcc10	A	T	17: 46,324,435	V214E	probably damaging	Het
Adh1	A	G	3: 138,286,795	D224G	probably damaging	Het
Arhgap28	C	A	17: 67,857,464	Q554H	probably damaging	Het
Atp8a2	T	C	14: 59,860,270	K770E	probably benign	Het
Brat1	G	A	5: 140,718,013	V674I	probably benign	Het
Brd2	ATCTTCTTC	ATCTTC	17: 34,114,007		probably benign	Het
Ccdc162	T	C	10: 41,553,182	D438G	possibly damaging	Het
Cyp4x1	T	A	4: 115,112,791		probably benign	Het
Dip2a	T	C	10: 76,279,820		probably benign	Het
Eif2s1	A	G	12: 78,881,168	D206G	probably benign	Het
Elovl7	T	A	13: 108,282,494	I220N	possibly damaging	Het
Gsto1	A	G	19: 47,857,942	E76G	probably damaging	Het
Hspa14	A	T	2: 3,508,821	W12R	probably damaging	Het
L3mbtl2	T	A	15: 81,676,317	C260S	possibly damaging	Het
Lama3	G	T	18: 12,481,098		probably null	Het
Lrrc34	T	A	3: 30,643,579		probably benign	Het
Lrrc45	A	T	11: 120,720,013	Q525L	probably benign	Het
Lss	T	C	10: 76,536,303	I164T	probably damaging	Het
Naip2	T	C	13: 100,161,854	E558G	probably benign	Het
Naip2	C	T	13: 100,161,860	G556D	probably benign	Het
Ncoa1	T	A	12: 4,270,737		probably benign	Het
Olfr262	G	T	19: 12,241,182	Q160K	possibly damaging	Het
Olfr768	A	T	10: 129,093,690	C95S	probably damaging	Het
Pafah1b3	T	C	7: 25,297,135	E41G	possibly damaging	Het
Pnmal1	C	T	7: 16,960,984	P255S	possibly damaging	Het
Prkar2b	A	T	12: 31,962,988		probably benign	Het
Rbck1	A	T	2: 152,327,241		probably benign	Het
Rcor2	A	G	19: 7,271,030	S137G	possibly damaging	Het
Slc25a48	T	A	13: 56,448,991		probably benign	Het
Slc7a4	A	G	16: 17,573,944		probably null	Het
Tert	T	C	13: 73,642,353		probably benign	Het
Traf7	A	T	17: 24,511,681	I344N	probably damaging	Het
Vmn1r194	T	A	13: 22,245,066	F284L	probably damaging	Het
Xpc	A	G	6: 91,493,238	M699T	probably damaging	Het
Zbtb5	T	C	4: 44,993,968	H472R	possibly damaging	Het
Zfp786	A	G	6: 47,825,079	V88A	probably benign	Het
Zkscan7	T	C	9: 122,895,163	I399T	probably benign	Het
Zyg11b	G	A	4: 108,250,812	R466C	probably damaging	Het

Other mutations in Myh11

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01362:Myh11	APN	16	14277722	missense	probably benign	0.00
IGL01398:Myh11	APN	16	14202100	missense	probably damaging	0.99
IGL01646:Myh11	APN	16	14221775	missense	probably damaging	1.00
IGL02470:Myh11	APN	16	14218046	missense	probably damaging	1.00
IGL02680:Myh11	APN	16	14209520	missense	probably benign	0.02
IGL02687:Myh11	APN	16	14212618	nonsense	probably null
IGL02987:Myh11	APN	16	14232532	missense	probably damaging	1.00
IGL03008:Myh11	APN	16	14204753	missense	probably benign	0.00
G5030:Myh11	UTSW	16	14250579	missense	probably damaging	1.00
PIT4618001:Myh11	UTSW	16	14201066	missense
R0008:Myh11	UTSW	16	14224019	missense	probably damaging	1.00
R0085:Myh11	UTSW	16	14224019	missense	probably damaging	1.00
R0086:Myh11	UTSW	16	14224019	missense	probably damaging	1.00
R0087:Myh11	UTSW	16	14224019	missense	probably damaging	1.00
R0096:Myh11	UTSW	16	14204367	missense	possibly damaging	0.94
R0096:Myh11	UTSW	16	14204367	missense	possibly damaging	0.94
R0207:Myh11	UTSW	16	14211260	missense	possibly damaging	0.95
R0326:Myh11	UTSW	16	14218880	missense	probably benign	0.32
R0546:Myh11	UTSW	16	14205628	missense	probably damaging	1.00
R0658:Myh11	UTSW	16	14224019	missense	probably damaging	1.00
R0715:Myh11	UTSW	16	14226616	missense	possibly damaging	0.89
R0839:Myh11	UTSW	16	14203178	missense	probably damaging	1.00
R1014:Myh11	UTSW	16	14236410	missense	possibly damaging	0.70
R1104:Myh11	UTSW	16	14202127	missense	possibly damaging	0.53
R1560:Myh11	UTSW	16	14226620	nonsense	probably null
R1714:Myh11	UTSW	16	14236368	critical splice donor site	probably null
R1742:Myh11	UTSW	16	14220044	missense	probably damaging	1.00
R1750:Myh11	UTSW	16	14200758	missense	probably damaging	1.00
R1750:Myh11	UTSW	16	14215790	missense	probably damaging	0.98
R1753:Myh11	UTSW	16	14277870	missense	probably benign
R1760:Myh11	UTSW	16	14233695	splice site	probably benign
R1829:Myh11	UTSW	16	14223880	missense	probably damaging	1.00
R1876:Myh11	UTSW	16	14269103	splice site	probably benign
R2027:Myh11	UTSW	16	14232668	missense	probably damaging	1.00
R2122:Myh11	UTSW	16	14218004	missense	probably damaging	1.00
R2247:Myh11	UTSW	16	14277559	missense	probably damaging	1.00
R2495:Myh11	UTSW	16	14205557	missense	probably damaging	1.00
R2863:Myh11	UTSW	16	14239426	missense	probably benign	0.02
R3684:Myh11	UTSW	16	14203234	missense	probably benign	0.00
R3693:Myh11	UTSW	16	14217949	missense	probably benign	0.01
R4080:Myh11	UTSW	16	14224059	missense	possibly damaging	0.83
R4367:Myh11	UTSW	16	14218883	missense	probably damaging	0.97
R4664:Myh11	UTSW	16	14226584	missense	possibly damaging	0.70
R4673:Myh11	UTSW	16	14269241	missense	probably damaging	0.99
R4694:Myh11	UTSW	16	14200702	missense	probably damaging	1.00
R4805:Myh11	UTSW	16	14234465	missense	possibly damaging	0.61
R4806:Myh11	UTSW	16	14201083	splice site	probably null
R4905:Myh11	UTSW	16	14250523	missense	probably benign	0.13
R4939:Myh11	UTSW	16	14239507	missense	probably benign
R4964:Myh11	UTSW	16	14205954	missense	probably damaging	1.00
R4966:Myh11	UTSW	16	14205954	missense	probably damaging	1.00
R5029:Myh11	UTSW	16	14205625	missense	probably damaging	1.00
R5045:Myh11	UTSW	16	14239527	nonsense	probably null
R5097:Myh11	UTSW	16	14205906	splice site	probably null
R5288:Myh11	UTSW	16	14208008	missense	possibly damaging	0.66
R5385:Myh11	UTSW	16	14208008	missense	possibly damaging	0.66
R5621:Myh11	UTSW	16	14244855	missense	probably damaging	0.96
R5856:Myh11	UTSW	16	14205976	missense	probably benign	0.00
R5869:Myh11	UTSW	16	14230800	missense	probably damaging	1.00
R6019:Myh11	UTSW	16	14206074	missense	probably damaging	1.00
R6024:Myh11	UTSW	16	14277703	missense	probably damaging	0.99
R6139:Myh11	UTSW	16	14215874	missense	probably damaging	1.00
R6209:Myh11	UTSW	16	14208291	nonsense	probably null
R6373:Myh11	UTSW	16	14205130	missense	possibly damaging	0.72
R6671:Myh11	UTSW	16	14226616	missense	possibly damaging	0.89
R6688:Myh11	UTSW	16	14205553	missense	probably damaging	1.00
R6709:Myh11	UTSW	16	14223494	critical splice donor site	probably null
R7069:Myh11	UTSW	16	14218939	missense	possibly damaging	0.95
R7176:Myh11	UTSW	16	14215826	missense
X0018:Myh11	UTSW	16	14277633	missense	probably damaging	1.00
X0025:Myh11	UTSW	16	14209689	missense	possibly damaging	0.93
X0027:Myh11	UTSW	16	14234402	missense	probably damaging	1.00
Z1088:Myh11	UTSW	16	14269262	frame shift	probably null

Predicted Primers

PCR Primer
(F):5'- CCTAGTAAGCAGAATGAGCAGAGCC -3'
(R):5'- TTCACATCTGGAGTTTGGTGAGCC -3'

Sequencing Primer
(F):5'- AGGCTTTGCCCTAATGGAATAG -3'
(R):5'- GGAGAAGAACATCTCCTCCAAGTATG -3'

Posted On

2014-03-14