Incidental Mutation 'R1426:Gsto1'
ID162271
Institutional Source Beutler Lab
Gene Symbol Gsto1
Ensembl Gene ENSMUSG00000025068
Gene Nameglutathione S-transferase omega 1
SynonymsGSTX, p28
MMRRC Submission 039482-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1426 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location47854970-47864790 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 47857942 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 76 (E76G)
Ref Sequence ENSEMBL: ENSMUSP00000026050 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026050]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000026048
Predicted Effect probably damaging
Transcript: ENSMUST00000026050
AA Change: E76G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000026050
Gene: ENSMUSG00000025068
AA Change: E76G

DomainStartEndE-ValueType
Pfam:GST_N 22 95 1.6e-15 PFAM
Pfam:GST_N_3 26 101 9e-24 PFAM
Pfam:GST_N_2 31 96 2.2e-16 PFAM
Pfam:GST_C_2 89 204 5.1e-10 PFAM
Pfam:GST_C 106 209 1.3e-10 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130157
Meta Mutation Damage Score 0.4674 question?
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.7%
  • 10x: 94.3%
  • 20x: 86.1%
Validation Efficiency 100% (40/40)
MGI Phenotype FUNCTION: This gene encodes a member of the omega class of glutathione S-transferase (GST) proteins. GSTs are involved in the metabolism of xenobiotics and carcinogens. There is evidence that the encoded protein is involved in the biotransformation of arsenic. [provided by RefSeq, Dec 2015]
PHENOTYPE: Mice homozygous for a mutant allele do not display abnormal arsenate metabolism following acute arsenate exposure. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc10 A T 17: 46,324,435 V214E probably damaging Het
Adh1 A G 3: 138,286,795 D224G probably damaging Het
Arhgap28 C A 17: 67,857,464 Q554H probably damaging Het
Atp8a2 T C 14: 59,860,270 K770E probably benign Het
Brat1 G A 5: 140,718,013 V674I probably benign Het
Brd2 ATCTTCTTC ATCTTC 17: 34,114,007 probably benign Het
Ccdc162 T C 10: 41,553,182 D438G possibly damaging Het
Cyp4x1 T A 4: 115,112,791 probably benign Het
Dip2a T C 10: 76,279,820 probably benign Het
Eif2s1 A G 12: 78,881,168 D206G probably benign Het
Elovl7 T A 13: 108,282,494 I220N possibly damaging Het
Hspa14 A T 2: 3,508,821 W12R probably damaging Het
L3mbtl2 T A 15: 81,676,317 C260S possibly damaging Het
Lama3 G T 18: 12,481,098 probably null Het
Lrrc34 T A 3: 30,643,579 probably benign Het
Lrrc45 A T 11: 120,720,013 Q525L probably benign Het
Lss T C 10: 76,536,303 I164T probably damaging Het
Myh11 T A 16: 14,205,931 K1527* probably null Het
Naip2 T C 13: 100,161,854 E558G probably benign Het
Naip2 C T 13: 100,161,860 G556D probably benign Het
Ncoa1 T A 12: 4,270,737 probably benign Het
Olfr262 G T 19: 12,241,182 Q160K possibly damaging Het
Olfr768 A T 10: 129,093,690 C95S probably damaging Het
Pafah1b3 T C 7: 25,297,135 E41G possibly damaging Het
Pnmal1 C T 7: 16,960,984 P255S possibly damaging Het
Prkar2b A T 12: 31,962,988 probably benign Het
Rbck1 A T 2: 152,327,241 probably benign Het
Rcor2 A G 19: 7,271,030 S137G possibly damaging Het
Slc25a48 T A 13: 56,448,991 probably benign Het
Slc7a4 A G 16: 17,573,944 probably null Het
Tert T C 13: 73,642,353 probably benign Het
Traf7 A T 17: 24,511,681 I344N probably damaging Het
Vmn1r194 T A 13: 22,245,066 F284L probably damaging Het
Xpc A G 6: 91,493,238 M699T probably damaging Het
Zbtb5 T C 4: 44,993,968 H472R possibly damaging Het
Zfp786 A G 6: 47,825,079 V88A probably benign Het
Zkscan7 T C 9: 122,895,163 I399T probably benign Het
Zyg11b G A 4: 108,250,812 R466C probably damaging Het
Other mutations in Gsto1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00570:Gsto1 APN 19 47857936 missense probably benign 0.24
R0277:Gsto1 UTSW 19 47857977 missense probably damaging 0.98
R1733:Gsto1 UTSW 19 47855235 missense probably damaging 1.00
R3418:Gsto1 UTSW 19 47857905 missense probably benign 0.01
R3419:Gsto1 UTSW 19 47857905 missense probably benign 0.01
R3710:Gsto1 UTSW 19 47859532 critical splice donor site probably null
R4830:Gsto1 UTSW 19 47864391 missense probably benign 0.01
R4953:Gsto1 UTSW 19 47855320 missense probably damaging 1.00
R5567:Gsto1 UTSW 19 47857899 missense probably damaging 1.00
R5570:Gsto1 UTSW 19 47857899 missense probably damaging 1.00
R6448:Gsto1 UTSW 19 47857981 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- GTGGAATCGGGCCACACTAATTCAG -3'
(R):5'- TTTCAGGAAGGCAGCAGGTCCAAG -3'

Sequencing Primer
(F):5'- GGCCACACTAATTCAGGGAGAC -3'
(R):5'- AGTTAAGGTTCCCAGTGCCAG -3'
Posted On2014-03-14