Incidental Mutation 'R1432:Myh14'
ID162301
Institutional Source Beutler Lab
Gene Symbol Myh14
Ensembl Gene ENSMUSG00000030739
Gene Namemyosin, heavy polypeptide 14
SynonymsNMHC II-C, 2400004E04Rik
MMRRC Submission 039487-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1432 (G1)
Quality Score163
Status Validated
Chromosome7
Chromosomal Location44605803-44670843 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 44616299 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 1585 (E1585G)
Ref Sequence ENSEMBL: ENSMUSP00000147115 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048102] [ENSMUST00000107899] [ENSMUST00000107900] [ENSMUST00000207775]
Predicted Effect probably damaging
Transcript: ENSMUST00000048102
AA Change: E1552G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000046059
Gene: ENSMUSG00000030739
AA Change: E1552G

DomainStartEndE-ValueType
low complexity region 62 80 N/A INTRINSIC
MYSc 95 805 N/A SMART
IQ 806 828 3.91e-4 SMART
Blast:MYSc 839 872 1e-12 BLAST
low complexity region 880 891 N/A INTRINSIC
low complexity region 926 937 N/A INTRINSIC
low complexity region 1005 1013 N/A INTRINSIC
low complexity region 1021 1029 N/A INTRINSIC
low complexity region 1030 1041 N/A INTRINSIC
Pfam:Myosin_tail_1 1094 1951 9.3e-180 PFAM
low complexity region 1955 1966 N/A INTRINSIC
low complexity region 1968 1997 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000107899
AA Change: E1544G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000103531
Gene: ENSMUSG00000030739
AA Change: E1544G

DomainStartEndE-ValueType
low complexity region 62 80 N/A INTRINSIC
MYSc 95 797 N/A SMART
IQ 798 820 3.91e-4 SMART
Blast:MYSc 831 864 1e-12 BLAST
low complexity region 872 883 N/A INTRINSIC
low complexity region 918 929 N/A INTRINSIC
low complexity region 997 1005 N/A INTRINSIC
low complexity region 1013 1021 N/A INTRINSIC
low complexity region 1022 1033 N/A INTRINSIC
Pfam:Myosin_tail_1 1086 1943 9e-180 PFAM
low complexity region 1947 1958 N/A INTRINSIC
low complexity region 1960 1989 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000107900
AA Change: E1552G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000103532
Gene: ENSMUSG00000030739
AA Change: E1552G

DomainStartEndE-ValueType
low complexity region 62 80 N/A INTRINSIC
MYSc 95 805 N/A SMART
IQ 806 828 3.91e-4 SMART
Pfam:Myosin_tail_1 869 1949 N/A PFAM
low complexity region 1955 1966 N/A INTRINSIC
low complexity region 1968 1997 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000207775
AA Change: E1585G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208044
Predicted Effect probably benign
Transcript: ENSMUST00000208200
Meta Mutation Damage Score 0.7627 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.8%
  • 10x: 94.4%
  • 20x: 86.1%
Validation Efficiency 98% (90/92)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the myosin superfamily. The protein represents a conventional non-muscle myosin; it should not be confused with the unconventional myosin-14 (MYO14). Myosins are actin-dependent motor proteins with diverse functions including regulation of cytokinesis, cell motility, and cell polarity. Mutations in this gene result in one form of autosomal dominant hearing impairment. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2011]
PHENOTYPE: Mice homozygous for a knock-out allele are healthy and survive to adulthood with no apparent defects. About 30% of knock-in mice either heterozygous or homozygous for a single amino acid mutation exhibit increased lymphoma incidence. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 88 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik A G 12: 71,170,587 probably null Het
9130401M01Rik A T 15: 58,028,860 L117Q probably damaging Het
Abcb1b A G 5: 8,837,771 K886E possibly damaging Het
Acaa2 A T 18: 74,787,127 I9F probably damaging Het
Acap2 A T 16: 31,111,083 S386T probably damaging Het
Acsm2 A T 7: 119,573,575 I138F possibly damaging Het
Agl T C 3: 116,746,693 Y1424C probably damaging Het
Apc2 T C 10: 80,312,349 V1079A probably benign Het
Arhgef6 T C X: 57,338,562 M5V probably benign Het
Armc8 C T 9: 99,523,132 probably benign Het
BC005561 T C 5: 104,518,104 F164S probably damaging Het
Catsperb A G 12: 101,622,217 Y953C probably damaging Het
Cdk13 G A 13: 17,718,416 A720V probably damaging Het
Chka T C 19: 3,874,809 probably benign Het
Clcc1 T C 3: 108,668,102 I165T probably benign Het
Cndp1 G A 18: 84,634,652 probably benign Het
Dip2c C A 13: 9,553,304 P297Q probably damaging Het
Dnah17 A T 11: 118,023,327 W4429R probably damaging Het
Doxl2 T A 6: 48,975,654 F171Y probably damaging Het
Dram2 T C 3: 106,570,766 V138A possibly damaging Het
Dus4l T C 12: 31,648,771 N78S probably benign Het
Dync1h1 G A 12: 110,636,509 E2195K probably benign Het
Ebf1 T C 11: 45,004,706 probably benign Het
Epm2a T A 10: 11,390,843 Y111N probably damaging Het
Gm773 T C X: 56,202,017 T52A probably benign Het
Gpam C A 19: 55,079,261 M483I probably damaging Het
Gpr12 T C 5: 146,583,425 H229R probably damaging Het
Gpr149 T C 3: 62,531,018 T573A probably damaging Het
Gtf3c3 C T 1: 54,417,778 A488T probably damaging Het
Hells T A 19: 38,957,184 probably null Het
Herc1 T A 9: 66,465,469 N3102K probably benign Het
Herc3 A T 6: 58,916,842 T968S possibly damaging Het
Ift88 A G 14: 57,437,279 Y69C probably benign Het
Incenp G A 19: 9,885,526 T388M unknown Het
Jrkl A G 9: 13,245,332 F108S probably benign Het
Khdc1a A G 1: 21,350,318 E54G possibly damaging Het
Kif6 T A 17: 49,620,700 F58L probably damaging Het
Klk14 T C 7: 43,694,918 S218P probably damaging Het
Kmt2e T C 5: 23,450,321 M19T probably benign Het
Llgl1 G T 11: 60,708,554 G454C probably damaging Het
Lyrm4 A G 13: 36,092,915 V33A probably benign Het
Mcam C T 9: 44,141,291 R606C probably damaging Het
Mgam T A 6: 40,756,367 M692K probably damaging Het
Mkl2 A G 16: 13,401,002 N504S probably benign Het
Mmp28 C T 11: 83,442,939 R392H probably damaging Het
Mpdz G A 4: 81,292,551 T1699M probably damaging Het
Mrps11 T C 7: 78,783,562 probably benign Het
Msmo1 A G 8: 64,727,616 probably benign Het
Mst1 A G 9: 108,084,204 E571G probably benign Het
Myrfl A G 10: 116,777,427 C824R probably damaging Het
Ncapd3 C T 9: 27,069,872 probably benign Het
Nlrp4a G GGTTCTTC 7: 26,464,197 probably null Het
Nos1 C T 5: 117,949,619 probably benign Het
Notch3 T C 17: 32,164,224 S47G probably benign Het
Npsr1 A G 9: 24,310,075 Y122C probably damaging Het
Olfr1335 T C 4: 118,809,238 M209V probably benign Het
Olfr339 C T 2: 36,421,643 L82F probably damaging Het
Olfr420 T A 1: 174,158,917 V48E possibly damaging Het
Olfr76 G T 19: 12,120,239 R158S possibly damaging Het
Olfr786 C T 10: 129,436,938 T42I probably damaging Het
Olfr877 T A 9: 37,855,252 L145M possibly damaging Het
Otog G T 7: 46,300,583 V2490F probably damaging Het
Pibf1 T C 14: 99,112,989 V191A probably benign Het
Pip A G 6: 41,849,918 M66V probably benign Het
Plxna2 C T 1: 194,767,463 R830C probably benign Het
Prkca A T 11: 107,939,520 V248E probably benign Het
Prmt7 T A 8: 106,237,284 L253* probably null Het
Prrc2a G T 17: 35,153,912 probably benign Het
Rasgrf1 A G 9: 90,012,800 D1091G probably benign Het
Rbm7 C A 9: 48,489,945 G161V probably benign Het
Scn1a A T 2: 66,322,429 I736N probably damaging Het
Skint6 A G 4: 112,869,524 probably benign Het
Slc22a2 C T 17: 12,584,308 H10Y possibly damaging Het
Sned1 G A 1: 93,281,654 V830M possibly damaging Het
Stam2 A G 2: 52,714,809 probably benign Het
Stk40 T C 4: 126,136,833 L282P probably damaging Het
Tas2r110 A G 6: 132,868,368 N121D probably damaging Het
Tbc1d32 A G 10: 56,017,662 Y1272H probably damaging Het
Tmem131l T C 3: 83,928,714 D696G probably damaging Het
Trdmt1 T C 2: 13,519,846 Y266C probably damaging Het
Trim5 G T 7: 104,279,519 H72N probably benign Het
Trim5 A C 7: 104,279,521 L71R probably benign Het
Twf2 T A 9: 106,214,813 probably benign Het
Ubap2l T C 3: 90,019,328 T580A probably benign Het
Ugt1a10 C T 1: 88,216,260 R201C probably damaging Het
Unc5a A G 13: 55,004,472 probably benign Het
Vmn2r85 T C 10: 130,425,286 N394S possibly damaging Het
Wrn A T 8: 33,319,141 probably benign Het
Other mutations in Myh14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01139:Myh14 APN 7 44606292 unclassified probably benign
IGL01431:Myh14 APN 7 44614358 missense probably null 0.00
IGL01722:Myh14 APN 7 44643532 missense probably damaging 1.00
IGL01806:Myh14 APN 7 44657939 missense probably benign 0.19
IGL02034:Myh14 APN 7 44616293 missense possibly damaging 0.58
IGL02260:Myh14 APN 7 44611571 missense probably damaging 1.00
IGL02590:Myh14 APN 7 44624079 missense probably damaging 1.00
IGL02696:Myh14 APN 7 44665106 missense probably damaging 1.00
IGL02705:Myh14 APN 7 44608536 missense possibly damaging 0.66
IGL03193:Myh14 APN 7 44629945 missense possibly damaging 0.91
PIT4581001:Myh14 UTSW 7 44613482 missense probably benign 0.04
R0067:Myh14 UTSW 7 44623127 missense probably benign 0.05
R0083:Myh14 UTSW 7 44634519 missense probably damaging 0.98
R0108:Myh14 UTSW 7 44634519 missense probably damaging 0.98
R0152:Myh14 UTSW 7 44623181 missense probably damaging 1.00
R0369:Myh14 UTSW 7 44660950 missense probably damaging 1.00
R0552:Myh14 UTSW 7 44613681 missense probably damaging 1.00
R0699:Myh14 UTSW 7 44624971 missense possibly damaging 0.67
R0763:Myh14 UTSW 7 44665367 missense probably damaging 0.98
R1079:Myh14 UTSW 7 44630002 missense probably damaging 1.00
R1388:Myh14 UTSW 7 44665122 missense probably damaging 0.98
R1568:Myh14 UTSW 7 44611698 nonsense probably null
R1579:Myh14 UTSW 7 44655694 splice site probably null
R1598:Myh14 UTSW 7 44638394 missense probably damaging 0.96
R1848:Myh14 UTSW 7 44632429 missense probably damaging 0.98
R1869:Myh14 UTSW 7 44611643 missense possibly damaging 0.95
R1917:Myh14 UTSW 7 44657925 missense probably benign
R1933:Myh14 UTSW 7 44615348 missense probably benign 0.09
R1984:Myh14 UTSW 7 44639022 missense probably damaging 1.00
R2154:Myh14 UTSW 7 44652429 critical splice donor site probably null
R2190:Myh14 UTSW 7 44661063 missense probably damaging 1.00
R2217:Myh14 UTSW 7 44634376 missense probably damaging 1.00
R2239:Myh14 UTSW 7 44665183 missense probably damaging 1.00
R2918:Myh14 UTSW 7 44616263 missense possibly damaging 0.91
R4091:Myh14 UTSW 7 44632991 missense possibly damaging 0.93
R4110:Myh14 UTSW 7 44628550 missense probably benign 0.00
R4199:Myh14 UTSW 7 44615503 nonsense probably null
R4507:Myh14 UTSW 7 44629991 missense probably benign 0.00
R4539:Myh14 UTSW 7 44627054 missense probably damaging 1.00
R4550:Myh14 UTSW 7 44634433 missense probably damaging 1.00
R4673:Myh14 UTSW 7 44624330 missense probably damaging 1.00
R4768:Myh14 UTSW 7 44613675 missense probably benign 0.19
R4832:Myh14 UTSW 7 44625142 missense probably benign 0.31
R4853:Myh14 UTSW 7 44608448 missense probably damaging 1.00
R4901:Myh14 UTSW 7 44661040 missense probably damaging 1.00
R4928:Myh14 UTSW 7 44635502 missense probably benign 0.00
R5070:Myh14 UTSW 7 44616248 missense possibly damaging 0.91
R5166:Myh14 UTSW 7 44628855 missense probably damaging 0.99
R5726:Myh14 UTSW 7 44643462 critical splice donor site probably null
R5786:Myh14 UTSW 7 44613463 missense probably benign 0.23
R5895:Myh14 UTSW 7 44606709 missense probably damaging 1.00
R5961:Myh14 UTSW 7 44623094 missense probably damaging 0.96
R6014:Myh14 UTSW 7 44625078 missense probably null
R6080:Myh14 UTSW 7 44655611 missense probably damaging 1.00
R6187:Myh14 UTSW 7 44627033 missense probably damaging 1.00
R6657:Myh14 UTSW 7 44637846 missense probably damaging 1.00
R6833:Myh14 UTSW 7 44624379 nonsense probably null
R6894:Myh14 UTSW 7 44633512 missense probably damaging 1.00
R6916:Myh14 UTSW 7 44629313 missense probably damaging 0.96
R6962:Myh14 UTSW 7 44657939 missense probably benign 0.36
R7066:Myh14 UTSW 7 44630755 missense possibly damaging 0.69
R7261:Myh14 UTSW 7 44624337 nonsense probably null
R7303:Myh14 UTSW 7 44611701 missense probably damaging 1.00
R7304:Myh14 UTSW 7 44629991 missense probably benign 0.00
R7327:Myh14 UTSW 7 44611553 missense possibly damaging 0.53
R7380:Myh14 UTSW 7 44661042 missense probably damaging 1.00
R7570:Myh14 UTSW 7 44632426 missense probably benign 0.37
R7622:Myh14 UTSW 7 44632422 missense probably benign 0.25
R7681:Myh14 UTSW 7 44624148 missense possibly damaging 0.81
R7718:Myh14 UTSW 7 44661040 missense probably damaging 1.00
R7910:Myh14 UTSW 7 44632395 missense probably damaging 1.00
R7991:Myh14 UTSW 7 44632395 missense probably damaging 1.00
R8054:Myh14 UTSW 7 44625127 missense probably damaging 0.97
R8088:Myh14 UTSW 7 44665496 start codon destroyed probably null 0.94
R8164:Myh14 UTSW 7 44625033 missense probably benign 0.01
R8260:Myh14 UTSW 7 44615376 missense probably damaging 1.00
R8299:Myh14 UTSW 7 44627048 missense probably damaging 1.00
X0026:Myh14 UTSW 7 44614394 missense probably benign 0.00
X0063:Myh14 UTSW 7 44624133 missense probably damaging 1.00
Z1176:Myh14 UTSW 7 44608515 missense probably damaging 1.00
Z1176:Myh14 UTSW 7 44638309 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TCTTCGGTGGAGCAGATGGCAA -3'
(R):5'- CCTGGTAGGTACTCAGTAACTCGTGT -3'

Sequencing Primer
(F):5'- tggtcactccatgtcctttc -3'
(R):5'- AGGTACTCAGTAACTCGTGTGAATG -3'
Posted On2014-03-14