Incidental Mutation 'R1432:Jrkl'
ID162310
Institutional Source Beutler Lab
Gene Symbol Jrkl
Ensembl Gene ENSMUSG00000079083
Gene NameJrk-like
SynonymsC030035D04Rik
MMRRC Submission 039487-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.160) question?
Stock #R1432 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location13242607-13245829 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 13245332 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 108 (F108S)
Ref Sequence ENSEMBL: ENSMUSP00000128798 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000110582] [ENSMUST00000110583] [ENSMUST00000217444]
Predicted Effect probably benign
Transcript: ENSMUST00000110582
AA Change: F108S

PolyPhen 2 Score 0.148 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000128798
Gene: ENSMUSG00000079083
AA Change: F108S

DomainStartEndE-ValueType
Pfam:CENP-B_N 4 54 6e-18 PFAM
CENPB 73 139 1.45e-24 SMART
Pfam:DDE_1 206 385 1e-58 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000110583
SMART Domains Protein: ENSMUSP00000106212
Gene: ENSMUSG00000079084

DomainStartEndE-ValueType
low complexity region 38 70 N/A INTRINSIC
Pfam:DUF4196 98 211 1.8e-50 PFAM
low complexity region 218 231 N/A INTRINSIC
Pfam:DUF4211 273 432 1e-36 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000169961
SMART Domains Protein: ENSMUSP00000126058
Gene: ENSMUSG00000079084

DomainStartEndE-ValueType
low complexity region 38 70 N/A INTRINSIC
Pfam:DUF4196 98 211 2.2e-55 PFAM
low complexity region 218 231 N/A INTRINSIC
low complexity region 250 273 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215735
Predicted Effect probably benign
Transcript: ENSMUST00000217444
Meta Mutation Damage Score 0.1073 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.8%
  • 10x: 94.4%
  • 20x: 86.1%
Validation Efficiency 98% (90/92)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The function of this gene has not yet been defined, however, the encoded protein shares similarity with the human (41% identical) and mouse (34% identical) jerky gene products. This protein may act as a nuclear regulatory protein. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, May 2012]
Allele List at MGI
Other mutations in this stock
Total: 88 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik A G 12: 71,170,587 probably null Het
9130401M01Rik A T 15: 58,028,860 L117Q probably damaging Het
Abcb1b A G 5: 8,837,771 K886E possibly damaging Het
Acaa2 A T 18: 74,787,127 I9F probably damaging Het
Acap2 A T 16: 31,111,083 S386T probably damaging Het
Acsm2 A T 7: 119,573,575 I138F possibly damaging Het
Agl T C 3: 116,746,693 Y1424C probably damaging Het
Apc2 T C 10: 80,312,349 V1079A probably benign Het
Arhgef6 T C X: 57,338,562 M5V probably benign Het
Armc8 C T 9: 99,523,132 probably benign Het
BC005561 T C 5: 104,518,104 F164S probably damaging Het
Catsperb A G 12: 101,622,217 Y953C probably damaging Het
Cdk13 G A 13: 17,718,416 A720V probably damaging Het
Chka T C 19: 3,874,809 probably benign Het
Clcc1 T C 3: 108,668,102 I165T probably benign Het
Cndp1 G A 18: 84,634,652 probably benign Het
Dip2c C A 13: 9,553,304 P297Q probably damaging Het
Dnah17 A T 11: 118,023,327 W4429R probably damaging Het
Doxl2 T A 6: 48,975,654 F171Y probably damaging Het
Dram2 T C 3: 106,570,766 V138A possibly damaging Het
Dus4l T C 12: 31,648,771 N78S probably benign Het
Dync1h1 G A 12: 110,636,509 E2195K probably benign Het
Ebf1 T C 11: 45,004,706 probably benign Het
Epm2a T A 10: 11,390,843 Y111N probably damaging Het
Gm773 T C X: 56,202,017 T52A probably benign Het
Gpam C A 19: 55,079,261 M483I probably damaging Het
Gpr12 T C 5: 146,583,425 H229R probably damaging Het
Gpr149 T C 3: 62,531,018 T573A probably damaging Het
Gtf3c3 C T 1: 54,417,778 A488T probably damaging Het
Hells T A 19: 38,957,184 probably null Het
Herc1 T A 9: 66,465,469 N3102K probably benign Het
Herc3 A T 6: 58,916,842 T968S possibly damaging Het
Ift88 A G 14: 57,437,279 Y69C probably benign Het
Incenp G A 19: 9,885,526 T388M unknown Het
Khdc1a A G 1: 21,350,318 E54G possibly damaging Het
Kif6 T A 17: 49,620,700 F58L probably damaging Het
Klk14 T C 7: 43,694,918 S218P probably damaging Het
Kmt2e T C 5: 23,450,321 M19T probably benign Het
Llgl1 G T 11: 60,708,554 G454C probably damaging Het
Lyrm4 A G 13: 36,092,915 V33A probably benign Het
Mcam C T 9: 44,141,291 R606C probably damaging Het
Mgam T A 6: 40,756,367 M692K probably damaging Het
Mkl2 A G 16: 13,401,002 N504S probably benign Het
Mmp28 C T 11: 83,442,939 R392H probably damaging Het
Mpdz G A 4: 81,292,551 T1699M probably damaging Het
Mrps11 T C 7: 78,783,562 probably benign Het
Msmo1 A G 8: 64,727,616 probably benign Het
Mst1 A G 9: 108,084,204 E571G probably benign Het
Myh14 T C 7: 44,616,299 E1585G probably damaging Het
Myrfl A G 10: 116,777,427 C824R probably damaging Het
Ncapd3 C T 9: 27,069,872 probably benign Het
Nlrp4a G GGTTCTTC 7: 26,464,197 probably null Het
Nos1 C T 5: 117,949,619 probably benign Het
Notch3 T C 17: 32,164,224 S47G probably benign Het
Npsr1 A G 9: 24,310,075 Y122C probably damaging Het
Olfr1335 T C 4: 118,809,238 M209V probably benign Het
Olfr339 C T 2: 36,421,643 L82F probably damaging Het
Olfr420 T A 1: 174,158,917 V48E possibly damaging Het
Olfr76 G T 19: 12,120,239 R158S possibly damaging Het
Olfr786 C T 10: 129,436,938 T42I probably damaging Het
Olfr877 T A 9: 37,855,252 L145M possibly damaging Het
Otog G T 7: 46,300,583 V2490F probably damaging Het
Pibf1 T C 14: 99,112,989 V191A probably benign Het
Pip A G 6: 41,849,918 M66V probably benign Het
Plxna2 C T 1: 194,767,463 R830C probably benign Het
Prkca A T 11: 107,939,520 V248E probably benign Het
Prmt7 T A 8: 106,237,284 L253* probably null Het
Prrc2a G T 17: 35,153,912 probably benign Het
Rasgrf1 A G 9: 90,012,800 D1091G probably benign Het
Rbm7 C A 9: 48,489,945 G161V probably benign Het
Scn1a A T 2: 66,322,429 I736N probably damaging Het
Skint6 A G 4: 112,869,524 probably benign Het
Slc22a2 C T 17: 12,584,308 H10Y possibly damaging Het
Sned1 G A 1: 93,281,654 V830M possibly damaging Het
Stam2 A G 2: 52,714,809 probably benign Het
Stk40 T C 4: 126,136,833 L282P probably damaging Het
Tas2r110 A G 6: 132,868,368 N121D probably damaging Het
Tbc1d32 A G 10: 56,017,662 Y1272H probably damaging Het
Tmem131l T C 3: 83,928,714 D696G probably damaging Het
Trdmt1 T C 2: 13,519,846 Y266C probably damaging Het
Trim5 G T 7: 104,279,519 H72N probably benign Het
Trim5 A C 7: 104,279,521 L71R probably benign Het
Twf2 T A 9: 106,214,813 probably benign Het
Ubap2l T C 3: 90,019,328 T580A probably benign Het
Ugt1a10 C T 1: 88,216,260 R201C probably damaging Het
Unc5a A G 13: 55,004,472 probably benign Het
Vmn2r85 T C 10: 130,425,286 N394S possibly damaging Het
Wrn A T 8: 33,319,141 probably benign Het
Other mutations in Jrkl
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1185:Jrkl UTSW 9 13244933 missense possibly damaging 0.69
R1185:Jrkl UTSW 9 13244933 missense possibly damaging 0.69
R1185:Jrkl UTSW 9 13244933 missense possibly damaging 0.69
R1914:Jrkl UTSW 9 13245604 missense possibly damaging 0.48
R1915:Jrkl UTSW 9 13245604 missense possibly damaging 0.48
R2079:Jrkl UTSW 9 13244859 missense probably damaging 1.00
R2155:Jrkl UTSW 9 13244908 nonsense probably null
R3714:Jrkl UTSW 9 13244231 missense possibly damaging 0.77
R3734:Jrkl UTSW 9 13245530 missense possibly damaging 0.95
R4394:Jrkl UTSW 9 13245141 nonsense probably null
R4486:Jrkl UTSW 9 13245371 missense probably benign 0.36
R5687:Jrkl UTSW 9 13244382 missense probably benign 0.07
R5724:Jrkl UTSW 9 13244886 missense possibly damaging 0.68
R6394:Jrkl UTSW 9 13245490 nonsense probably null
R7002:Jrkl UTSW 9 13245521 missense probably damaging 1.00
R7196:Jrkl UTSW 9 13244157 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- TCCAAATTGTTATGGAGAAGACCTGCAC -3'
(R):5'- ACTTATGCAAGCAGCTCTGATTCCAC -3'

Sequencing Primer
(F):5'- ccttgctttgcccacaac -3'
(R):5'- GCAGCTCTGATTCCACAAGTC -3'
Posted On2014-03-14