Incidental Mutation 'R1432:Mst1'
ID162320
Institutional Source Beutler Lab
Gene Symbol Mst1
Ensembl Gene ENSMUSG00000032591
Gene Namemacrophage stimulating 1 (hepatocyte growth factor-like)
SynonymsD9H3F15S2, DNF15S2h, D3F15S2h, Hgfl
MMRRC Submission 039487-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1432 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location108080436-108085003 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 108084204 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 571 (E571G)
Ref Sequence ENSEMBL: ENSMUSP00000125175 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035211] [ENSMUST00000047746] [ENSMUST00000159372] [ENSMUST00000160249] [ENSMUST00000160649] [ENSMUST00000162355] [ENSMUST00000162516] [ENSMUST00000162886] [ENSMUST00000174504] [ENSMUST00000178267] [ENSMUST00000193254]
Predicted Effect probably benign
Transcript: ENSMUST00000035211
AA Change: E580G

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000035211
Gene: ENSMUSG00000032591
AA Change: E580G

DomainStartEndE-ValueType
PAN_AP 21 104 2.65e-9 SMART
KR 108 188 3.13e-39 SMART
KR 189 270 8.57e-46 SMART
KR 290 372 7.94e-41 SMART
KR 377 459 6.59e-47 SMART
Tryp_SPc 488 709 2.27e-55 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000047746
SMART Domains Protein: ENSMUSP00000040803
Gene: ENSMUSG00000041528

DomainStartEndE-ValueType
low complexity region 104 115 N/A INTRINSIC
SPRY 132 253 1.52e-28 SMART
low complexity region 471 488 N/A INTRINSIC
low complexity region 508 518 N/A INTRINSIC
coiled coil region 1047 1067 N/A INTRINSIC
low complexity region 1242 1251 N/A INTRINSIC
RING 1260 1297 5.27e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000081309
SMART Domains Protein: ENSMUSP00000080058
Gene: ENSMUSG00000032590

DomainStartEndE-ValueType
Pfam:DLH 485 721 2e-8 PFAM
Pfam:Abhydrolase_1 501 633 3.8e-9 PFAM
Pfam:Abhydrolase_5 501 708 5e-16 PFAM
Pfam:Peptidase_S9 516 732 1.6e-38 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159136
Predicted Effect probably benign
Transcript: ENSMUST00000159372
Predicted Effect probably benign
Transcript: ENSMUST00000160184
Predicted Effect probably benign
Transcript: ENSMUST00000160249
SMART Domains Protein: ENSMUSP00000124548
Gene: ENSMUSG00000041528

DomainStartEndE-ValueType
low complexity region 104 115 N/A INTRINSIC
SPRY 132 253 1.52e-28 SMART
low complexity region 471 488 N/A INTRINSIC
low complexity region 508 518 N/A INTRINSIC
coiled coil region 1041 1061 N/A INTRINSIC
low complexity region 1236 1245 N/A INTRINSIC
RING 1254 1291 5.27e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000160649
SMART Domains Protein: ENSMUSP00000125495
Gene: ENSMUSG00000041528

DomainStartEndE-ValueType
low complexity region 104 115 N/A INTRINSIC
SPRY 132 253 1.52e-28 SMART
low complexity region 471 488 N/A INTRINSIC
low complexity region 508 518 N/A INTRINSIC
coiled coil region 1041 1061 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000161253
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161673
Predicted Effect probably benign
Transcript: ENSMUST00000162355
SMART Domains Protein: ENSMUSP00000125745
Gene: ENSMUSG00000041528

DomainStartEndE-ValueType
low complexity region 104 115 N/A INTRINSIC
SPRY 132 253 1.52e-28 SMART
low complexity region 471 488 N/A INTRINSIC
low complexity region 508 518 N/A INTRINSIC
coiled coil region 1047 1067 N/A INTRINSIC
low complexity region 1242 1251 N/A INTRINSIC
RING 1260 1297 5.27e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000162516
Predicted Effect probably benign
Transcript: ENSMUST00000162886
AA Change: E571G

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000125175
Gene: ENSMUSG00000032591
AA Change: E571G

DomainStartEndE-ValueType
PAN_AP 21 104 2.65e-9 SMART
KR 108 188 3.13e-39 SMART
KR 189 270 1.07e-46 SMART
KR 281 363 7.94e-41 SMART
KR 368 450 6.59e-47 SMART
Tryp_SPc 479 700 2.27e-55 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000174504
Predicted Effect probably benign
Transcript: ENSMUST00000178267
SMART Domains Protein: ENSMUSP00000136953
Gene: ENSMUSG00000041528

DomainStartEndE-ValueType
low complexity region 104 115 N/A INTRINSIC
SPRY 132 253 1.52e-28 SMART
low complexity region 471 488 N/A INTRINSIC
low complexity region 508 518 N/A INTRINSIC
coiled coil region 1041 1061 N/A INTRINSIC
low complexity region 1236 1245 N/A INTRINSIC
RING 1254 1291 5.27e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184227
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191754
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192916
Predicted Effect probably benign
Transcript: ENSMUST00000193254
SMART Domains Protein: ENSMUSP00000141856
Gene: ENSMUSG00000032590

DomainStartEndE-ValueType
Pfam:DLH 485 721 4.8e-8 PFAM
Pfam:Abhydrolase_5 501 708 5.7e-16 PFAM
Pfam:Abhydrolase_6 503 714 6.2e-14 PFAM
Pfam:Peptidase_S9 515 732 1.4e-38 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194014
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194083
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194915
Meta Mutation Damage Score 0.2424 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.8%
  • 10x: 94.4%
  • 20x: 86.1%
Validation Efficiency 98% (90/92)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains four kringle domains and a serine protease domain, similar to that found in hepatic growth factor. Despite the presence of the serine protease domain, the encoded protein may not have any proteolytic activity. The receptor for this protein is RON tyrosine kinase, which upon activation stimulates ciliary motility of ciliated epithelial lung cells. This protein is secreted and cleaved to form an alpha chain and a beta chain bridged by disulfide bonds. [provided by RefSeq, Jan 2010]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit lipid-filled cytoplasmic vacuoles in hepatocytes throughout the liver lobules. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 88 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik A G 12: 71,170,587 probably null Het
9130401M01Rik A T 15: 58,028,860 L117Q probably damaging Het
Abcb1b A G 5: 8,837,771 K886E possibly damaging Het
Acaa2 A T 18: 74,787,127 I9F probably damaging Het
Acap2 A T 16: 31,111,083 S386T probably damaging Het
Acsm2 A T 7: 119,573,575 I138F possibly damaging Het
Agl T C 3: 116,746,693 Y1424C probably damaging Het
Apc2 T C 10: 80,312,349 V1079A probably benign Het
Arhgef6 T C X: 57,338,562 M5V probably benign Het
Armc8 C T 9: 99,523,132 probably benign Het
BC005561 T C 5: 104,518,104 F164S probably damaging Het
Catsperb A G 12: 101,622,217 Y953C probably damaging Het
Cdk13 G A 13: 17,718,416 A720V probably damaging Het
Chka T C 19: 3,874,809 probably benign Het
Clcc1 T C 3: 108,668,102 I165T probably benign Het
Cndp1 G A 18: 84,634,652 probably benign Het
Dip2c C A 13: 9,553,304 P297Q probably damaging Het
Dnah17 A T 11: 118,023,327 W4429R probably damaging Het
Doxl2 T A 6: 48,975,654 F171Y probably damaging Het
Dram2 T C 3: 106,570,766 V138A possibly damaging Het
Dus4l T C 12: 31,648,771 N78S probably benign Het
Dync1h1 G A 12: 110,636,509 E2195K probably benign Het
Ebf1 T C 11: 45,004,706 probably benign Het
Epm2a T A 10: 11,390,843 Y111N probably damaging Het
Gm773 T C X: 56,202,017 T52A probably benign Het
Gpam C A 19: 55,079,261 M483I probably damaging Het
Gpr12 T C 5: 146,583,425 H229R probably damaging Het
Gpr149 T C 3: 62,531,018 T573A probably damaging Het
Gtf3c3 C T 1: 54,417,778 A488T probably damaging Het
Hells T A 19: 38,957,184 probably null Het
Herc1 T A 9: 66,465,469 N3102K probably benign Het
Herc3 A T 6: 58,916,842 T968S possibly damaging Het
Ift88 A G 14: 57,437,279 Y69C probably benign Het
Incenp G A 19: 9,885,526 T388M unknown Het
Jrkl A G 9: 13,245,332 F108S probably benign Het
Khdc1a A G 1: 21,350,318 E54G possibly damaging Het
Kif6 T A 17: 49,620,700 F58L probably damaging Het
Klk14 T C 7: 43,694,918 S218P probably damaging Het
Kmt2e T C 5: 23,450,321 M19T probably benign Het
Llgl1 G T 11: 60,708,554 G454C probably damaging Het
Lyrm4 A G 13: 36,092,915 V33A probably benign Het
Mcam C T 9: 44,141,291 R606C probably damaging Het
Mgam T A 6: 40,756,367 M692K probably damaging Het
Mkl2 A G 16: 13,401,002 N504S probably benign Het
Mmp28 C T 11: 83,442,939 R392H probably damaging Het
Mpdz G A 4: 81,292,551 T1699M probably damaging Het
Mrps11 T C 7: 78,783,562 probably benign Het
Msmo1 A G 8: 64,727,616 probably benign Het
Myh14 T C 7: 44,616,299 E1585G probably damaging Het
Myrfl A G 10: 116,777,427 C824R probably damaging Het
Ncapd3 C T 9: 27,069,872 probably benign Het
Nlrp4a G GGTTCTTC 7: 26,464,197 probably null Het
Nos1 C T 5: 117,949,619 probably benign Het
Notch3 T C 17: 32,164,224 S47G probably benign Het
Npsr1 A G 9: 24,310,075 Y122C probably damaging Het
Olfr1335 T C 4: 118,809,238 M209V probably benign Het
Olfr339 C T 2: 36,421,643 L82F probably damaging Het
Olfr420 T A 1: 174,158,917 V48E possibly damaging Het
Olfr76 G T 19: 12,120,239 R158S possibly damaging Het
Olfr786 C T 10: 129,436,938 T42I probably damaging Het
Olfr877 T A 9: 37,855,252 L145M possibly damaging Het
Otog G T 7: 46,300,583 V2490F probably damaging Het
Pibf1 T C 14: 99,112,989 V191A probably benign Het
Pip A G 6: 41,849,918 M66V probably benign Het
Plxna2 C T 1: 194,767,463 R830C probably benign Het
Prkca A T 11: 107,939,520 V248E probably benign Het
Prmt7 T A 8: 106,237,284 L253* probably null Het
Prrc2a G T 17: 35,153,912 probably benign Het
Rasgrf1 A G 9: 90,012,800 D1091G probably benign Het
Rbm7 C A 9: 48,489,945 G161V probably benign Het
Scn1a A T 2: 66,322,429 I736N probably damaging Het
Skint6 A G 4: 112,869,524 probably benign Het
Slc22a2 C T 17: 12,584,308 H10Y possibly damaging Het
Sned1 G A 1: 93,281,654 V830M possibly damaging Het
Stam2 A G 2: 52,714,809 probably benign Het
Stk40 T C 4: 126,136,833 L282P probably damaging Het
Tas2r110 A G 6: 132,868,368 N121D probably damaging Het
Tbc1d32 A G 10: 56,017,662 Y1272H probably damaging Het
Tmem131l T C 3: 83,928,714 D696G probably damaging Het
Trdmt1 T C 2: 13,519,846 Y266C probably damaging Het
Trim5 G T 7: 104,279,519 H72N probably benign Het
Trim5 A C 7: 104,279,521 L71R probably benign Het
Twf2 T A 9: 106,214,813 probably benign Het
Ubap2l T C 3: 90,019,328 T580A probably benign Het
Ugt1a10 C T 1: 88,216,260 R201C probably damaging Het
Unc5a A G 13: 55,004,472 probably benign Het
Vmn2r85 T C 10: 130,425,286 N394S possibly damaging Het
Wrn A T 8: 33,319,141 probably benign Het
Other mutations in Mst1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01364:Mst1 APN 9 108081601 missense probably benign 0.03
IGL01380:Mst1 APN 9 108084588 missense probably damaging 1.00
IGL01420:Mst1 APN 9 108082828 missense probably damaging 0.99
IGL02931:Mst1 APN 9 108084642 intron probably null
IGL03059:Mst1 APN 9 108084813 missense probably damaging 1.00
IGL03275:Mst1 APN 9 108084388 missense possibly damaging 0.70
R0319:Mst1 UTSW 9 108082513 missense probably benign 0.05
R0361:Mst1 UTSW 9 108084897 missense probably damaging 0.98
R0412:Mst1 UTSW 9 108083594 missense probably benign 0.06
R0569:Mst1 UTSW 9 108082301 missense probably damaging 0.98
R1483:Mst1 UTSW 9 108081650 missense probably benign 0.03
R1859:Mst1 UTSW 9 108084346 missense probably benign 0.23
R2187:Mst1 UTSW 9 108084340 missense possibly damaging 0.63
R2393:Mst1 UTSW 9 108082952 critical splice donor site probably null
R3522:Mst1 UTSW 9 108081503 unclassified probably benign
R3916:Mst1 UTSW 9 108084295 missense probably benign 0.00
R3917:Mst1 UTSW 9 108084295 missense probably benign 0.00
R3945:Mst1 UTSW 9 108084853 missense probably damaging 1.00
R4006:Mst1 UTSW 9 108082948 missense possibly damaging 0.52
R4007:Mst1 UTSW 9 108082948 missense possibly damaging 0.52
R4737:Mst1 UTSW 9 108080521 missense probably benign 0.00
R4756:Mst1 UTSW 9 108083627 missense probably benign 0.28
R5047:Mst1 UTSW 9 108084309 missense probably benign 0.17
R5113:Mst1 UTSW 9 108082247 missense probably damaging 1.00
R5278:Mst1 UTSW 9 108082215 missense probably damaging 0.99
R5279:Mst1 UTSW 9 108082215 missense probably damaging 0.99
R5402:Mst1 UTSW 9 108084209 critical splice donor site probably null
R5677:Mst1 UTSW 9 108081286 missense probably damaging 0.98
R5712:Mst1 UTSW 9 108082908 missense probably damaging 1.00
R6717:Mst1 UTSW 9 108080575 intron probably null
R7059:Mst1 UTSW 9 108084064 missense probably benign 0.44
R7131:Mst1 UTSW 9 108084931 missense probably null 0.07
R7139:Mst1 UTSW 9 108082828 missense probably damaging 0.99
R7219:Mst1 UTSW 9 108081286 missense probably damaging 0.99
R7501:Mst1 UTSW 9 108082549 missense probably damaging 1.00
X0028:Mst1 UTSW 9 108082217 missense probably benign
Predicted Primers PCR Primer
(F):5'- GCCATTGTCTGTCCCACAAGCAAAC -3'
(R):5'- CAGTCCATGTCTATGCACTGTGCTC -3'

Sequencing Primer
(F):5'- TTGGGAGTCAAGCATGAACTAGC -3'
(R):5'- ACTGTGCTCTTACCGATGG -3'
Posted On2014-03-14