Incidental Mutation 'R1432:Olfr76'
ID162353
Institutional Source Beutler Lab
Gene Symbol Olfr76
Ensembl Gene ENSMUSG00000067522
Gene Nameolfactory receptor 76
SynonymsMOR215-3, V5, GA_x6K02T2RE5P-2479601-2478648
MMRRC Submission 039487-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.171) question?
Stock #R1432 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location12117996-12123203 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 12120239 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Serine at position 158 (R158S)
Ref Sequence ENSEMBL: ENSMUSP00000154269 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087822] [ENSMUST00000208391] [ENSMUST00000213471] [ENSMUST00000214103] [ENSMUST00000214676]
Predicted Effect probably benign
Transcript: ENSMUST00000087822
AA Change: R146S

PolyPhen 2 Score 0.321 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000085124
Gene: ENSMUSG00000067522
AA Change: R146S

DomainStartEndE-ValueType
Pfam:7tm_4 34 311 9.2e-54 PFAM
Pfam:7tm_1 44 293 5.6e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000208391
Predicted Effect possibly damaging
Transcript: ENSMUST00000213471
AA Change: R158S

PolyPhen 2 Score 0.556 (Sensitivity: 0.88; Specificity: 0.91)
Predicted Effect probably benign
Transcript: ENSMUST00000214103
Predicted Effect probably benign
Transcript: ENSMUST00000214676
AA Change: R146S

PolyPhen 2 Score 0.321 (Sensitivity: 0.90; Specificity: 0.89)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216205
Meta Mutation Damage Score 0.1444 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.8%
  • 10x: 94.4%
  • 20x: 86.1%
Validation Efficiency 98% (90/92)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 88 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik A G 12: 71,170,587 probably null Het
9130401M01Rik A T 15: 58,028,860 L117Q probably damaging Het
Abcb1b A G 5: 8,837,771 K886E possibly damaging Het
Acaa2 A T 18: 74,787,127 I9F probably damaging Het
Acap2 A T 16: 31,111,083 S386T probably damaging Het
Acsm2 A T 7: 119,573,575 I138F possibly damaging Het
Agl T C 3: 116,746,693 Y1424C probably damaging Het
Apc2 T C 10: 80,312,349 V1079A probably benign Het
Arhgef6 T C X: 57,338,562 M5V probably benign Het
Armc8 C T 9: 99,523,132 probably benign Het
BC005561 T C 5: 104,518,104 F164S probably damaging Het
Catsperb A G 12: 101,622,217 Y953C probably damaging Het
Cdk13 G A 13: 17,718,416 A720V probably damaging Het
Chka T C 19: 3,874,809 probably benign Het
Clcc1 T C 3: 108,668,102 I165T probably benign Het
Cndp1 G A 18: 84,634,652 probably benign Het
Dip2c C A 13: 9,553,304 P297Q probably damaging Het
Dnah17 A T 11: 118,023,327 W4429R probably damaging Het
Doxl2 T A 6: 48,975,654 F171Y probably damaging Het
Dram2 T C 3: 106,570,766 V138A possibly damaging Het
Dus4l T C 12: 31,648,771 N78S probably benign Het
Dync1h1 G A 12: 110,636,509 E2195K probably benign Het
Ebf1 T C 11: 45,004,706 probably benign Het
Epm2a T A 10: 11,390,843 Y111N probably damaging Het
Gm773 T C X: 56,202,017 T52A probably benign Het
Gpam C A 19: 55,079,261 M483I probably damaging Het
Gpr12 T C 5: 146,583,425 H229R probably damaging Het
Gpr149 T C 3: 62,531,018 T573A probably damaging Het
Gtf3c3 C T 1: 54,417,778 A488T probably damaging Het
Hells T A 19: 38,957,184 probably null Het
Herc1 T A 9: 66,465,469 N3102K probably benign Het
Herc3 A T 6: 58,916,842 T968S possibly damaging Het
Ift88 A G 14: 57,437,279 Y69C probably benign Het
Incenp G A 19: 9,885,526 T388M unknown Het
Jrkl A G 9: 13,245,332 F108S probably benign Het
Khdc1a A G 1: 21,350,318 E54G possibly damaging Het
Kif6 T A 17: 49,620,700 F58L probably damaging Het
Klk14 T C 7: 43,694,918 S218P probably damaging Het
Kmt2e T C 5: 23,450,321 M19T probably benign Het
Llgl1 G T 11: 60,708,554 G454C probably damaging Het
Lyrm4 A G 13: 36,092,915 V33A probably benign Het
Mcam C T 9: 44,141,291 R606C probably damaging Het
Mgam T A 6: 40,756,367 M692K probably damaging Het
Mkl2 A G 16: 13,401,002 N504S probably benign Het
Mmp28 C T 11: 83,442,939 R392H probably damaging Het
Mpdz G A 4: 81,292,551 T1699M probably damaging Het
Mrps11 T C 7: 78,783,562 probably benign Het
Msmo1 A G 8: 64,727,616 probably benign Het
Mst1 A G 9: 108,084,204 E571G probably benign Het
Myh14 T C 7: 44,616,299 E1585G probably damaging Het
Myrfl A G 10: 116,777,427 C824R probably damaging Het
Ncapd3 C T 9: 27,069,872 probably benign Het
Nlrp4a G GGTTCTTC 7: 26,464,197 probably null Het
Nos1 C T 5: 117,949,619 probably benign Het
Notch3 T C 17: 32,164,224 S47G probably benign Het
Npsr1 A G 9: 24,310,075 Y122C probably damaging Het
Olfr1335 T C 4: 118,809,238 M209V probably benign Het
Olfr339 C T 2: 36,421,643 L82F probably damaging Het
Olfr420 T A 1: 174,158,917 V48E possibly damaging Het
Olfr786 C T 10: 129,436,938 T42I probably damaging Het
Olfr877 T A 9: 37,855,252 L145M possibly damaging Het
Otog G T 7: 46,300,583 V2490F probably damaging Het
Pibf1 T C 14: 99,112,989 V191A probably benign Het
Pip A G 6: 41,849,918 M66V probably benign Het
Plxna2 C T 1: 194,767,463 R830C probably benign Het
Prkca A T 11: 107,939,520 V248E probably benign Het
Prmt7 T A 8: 106,237,284 L253* probably null Het
Prrc2a G T 17: 35,153,912 probably benign Het
Rasgrf1 A G 9: 90,012,800 D1091G probably benign Het
Rbm7 C A 9: 48,489,945 G161V probably benign Het
Scn1a A T 2: 66,322,429 I736N probably damaging Het
Skint6 A G 4: 112,869,524 probably benign Het
Slc22a2 C T 17: 12,584,308 H10Y possibly damaging Het
Sned1 G A 1: 93,281,654 V830M possibly damaging Het
Stam2 A G 2: 52,714,809 probably benign Het
Stk40 T C 4: 126,136,833 L282P probably damaging Het
Tas2r110 A G 6: 132,868,368 N121D probably damaging Het
Tbc1d32 A G 10: 56,017,662 Y1272H probably damaging Het
Tmem131l T C 3: 83,928,714 D696G probably damaging Het
Trdmt1 T C 2: 13,519,846 Y266C probably damaging Het
Trim5 G T 7: 104,279,519 H72N probably benign Het
Trim5 A C 7: 104,279,521 L71R probably benign Het
Twf2 T A 9: 106,214,813 probably benign Het
Ubap2l T C 3: 90,019,328 T580A probably benign Het
Ugt1a10 C T 1: 88,216,260 R201C probably damaging Het
Unc5a A G 13: 55,004,472 probably benign Het
Vmn2r85 T C 10: 130,425,286 N394S possibly damaging Het
Wrn A T 8: 33,319,141 probably benign Het
Other mutations in Olfr76
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01099:Olfr76 APN 19 12119876 missense probably damaging 1.00
IGL01693:Olfr76 APN 19 12120557 missense probably benign
R0360:Olfr76 UTSW 19 12119853 missense possibly damaging 0.84
R0399:Olfr76 UTSW 19 12120370 missense possibly damaging 0.67
R0467:Olfr76 UTSW 19 12120536 missense probably benign 0.01
R0750:Olfr76 UTSW 19 12120713 splice site probably null
R1535:Olfr76 UTSW 19 12120332 missense probably damaging 1.00
R4739:Olfr76 UTSW 19 12119870 missense possibly damaging 0.65
R4767:Olfr76 UTSW 19 12119936 missense probably damaging 1.00
R5032:Olfr76 UTSW 19 12120056 missense probably benign 0.00
R5367:Olfr76 UTSW 19 12120436 missense possibly damaging 0.90
R6363:Olfr76 UTSW 19 12120166 missense possibly damaging 0.60
R6426:Olfr76 UTSW 19 12119848 missense probably benign 0.04
R7162:Olfr76 UTSW 19 12120137 missense possibly damaging 0.60
R7224:Olfr76 UTSW 19 12120548 missense probably benign 0.00
R7565:Olfr76 UTSW 19 12120011 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GTACATGAAAAGTGCCGTCCCAAAC -3'
(R):5'- TCTGTAGCTCCCAAGATGCTCTCTG -3'

Sequencing Primer
(F):5'- CTCTCACAGAGTGGATCTTCAAG -3'
(R):5'- AAGATGCTCTCTGATTTCTTTCG -3'
Posted On2014-03-14