Incidental Mutation 'R1432:Hells'
ID162354
Institutional Source Beutler Lab
Gene Symbol Hells
Ensembl Gene ENSMUSG00000025001
Gene Namehelicase, lymphoid specific
SynonymsYFK8, LSH, proliferation-associated SNF2-like, PASG, Lysh, E130115I21Rik
MMRRC Submission 039487-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1432 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location38930915-38971051 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to A at 38957184 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000025965 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025965]
Predicted Effect probably null
Transcript: ENSMUST00000025965
SMART Domains Protein: ENSMUSP00000025965
Gene: ENSMUSG00000025001

DomainStartEndE-ValueType
low complexity region 13 29 N/A INTRINSIC
Blast:DEXDc 40 144 4e-22 BLAST
DEXDc 202 394 7.04e-31 SMART
HELICc 612 695 5.6e-25 SMART
low complexity region 775 791 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155465
Meta Mutation Damage Score 0.6056 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.8%
  • 10x: 94.4%
  • 20x: 86.1%
Validation Efficiency 98% (90/92)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a lymphoid-specific helicase. Other helicases function in processes involving DNA strand separation, including replication, repair, recombination, and transcription. This protein is thought to be involved with cellular proliferation and may play a role in leukemogenesis. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jan 2014]
PHENOTYPE: Homozygotes for a null allele show DNA hypomethylation, delayed growth, multiorgan and skeletal defects, premature graying, alopecia, low fat deposition, kyphosis, cachexia and early death. Homozygotes for another null allele show neonatal death, low birth weight, lymphoid defects and renal lesions. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 88 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik A G 12: 71,170,587 probably null Het
9130401M01Rik A T 15: 58,028,860 L117Q probably damaging Het
Abcb1b A G 5: 8,837,771 K886E possibly damaging Het
Acaa2 A T 18: 74,787,127 I9F probably damaging Het
Acap2 A T 16: 31,111,083 S386T probably damaging Het
Acsm2 A T 7: 119,573,575 I138F possibly damaging Het
Agl T C 3: 116,746,693 Y1424C probably damaging Het
Apc2 T C 10: 80,312,349 V1079A probably benign Het
Arhgef6 T C X: 57,338,562 M5V probably benign Het
Armc8 C T 9: 99,523,132 probably benign Het
BC005561 T C 5: 104,518,104 F164S probably damaging Het
Catsperb A G 12: 101,622,217 Y953C probably damaging Het
Cdk13 G A 13: 17,718,416 A720V probably damaging Het
Chka T C 19: 3,874,809 probably benign Het
Clcc1 T C 3: 108,668,102 I165T probably benign Het
Cndp1 G A 18: 84,634,652 probably benign Het
Dip2c C A 13: 9,553,304 P297Q probably damaging Het
Dnah17 A T 11: 118,023,327 W4429R probably damaging Het
Doxl2 T A 6: 48,975,654 F171Y probably damaging Het
Dram2 T C 3: 106,570,766 V138A possibly damaging Het
Dus4l T C 12: 31,648,771 N78S probably benign Het
Dync1h1 G A 12: 110,636,509 E2195K probably benign Het
Ebf1 T C 11: 45,004,706 probably benign Het
Epm2a T A 10: 11,390,843 Y111N probably damaging Het
Gm773 T C X: 56,202,017 T52A probably benign Het
Gpam C A 19: 55,079,261 M483I probably damaging Het
Gpr12 T C 5: 146,583,425 H229R probably damaging Het
Gpr149 T C 3: 62,531,018 T573A probably damaging Het
Gtf3c3 C T 1: 54,417,778 A488T probably damaging Het
Herc1 T A 9: 66,465,469 N3102K probably benign Het
Herc3 A T 6: 58,916,842 T968S possibly damaging Het
Ift88 A G 14: 57,437,279 Y69C probably benign Het
Incenp G A 19: 9,885,526 T388M unknown Het
Jrkl A G 9: 13,245,332 F108S probably benign Het
Khdc1a A G 1: 21,350,318 E54G possibly damaging Het
Kif6 T A 17: 49,620,700 F58L probably damaging Het
Klk14 T C 7: 43,694,918 S218P probably damaging Het
Kmt2e T C 5: 23,450,321 M19T probably benign Het
Llgl1 G T 11: 60,708,554 G454C probably damaging Het
Lyrm4 A G 13: 36,092,915 V33A probably benign Het
Mcam C T 9: 44,141,291 R606C probably damaging Het
Mgam T A 6: 40,756,367 M692K probably damaging Het
Mkl2 A G 16: 13,401,002 N504S probably benign Het
Mmp28 C T 11: 83,442,939 R392H probably damaging Het
Mpdz G A 4: 81,292,551 T1699M probably damaging Het
Mrps11 T C 7: 78,783,562 probably benign Het
Msmo1 A G 8: 64,727,616 probably benign Het
Mst1 A G 9: 108,084,204 E571G probably benign Het
Myh14 T C 7: 44,616,299 E1585G probably damaging Het
Myrfl A G 10: 116,777,427 C824R probably damaging Het
Ncapd3 C T 9: 27,069,872 probably benign Het
Nlrp4a G GGTTCTTC 7: 26,464,197 probably null Het
Nos1 C T 5: 117,949,619 probably benign Het
Notch3 T C 17: 32,164,224 S47G probably benign Het
Npsr1 A G 9: 24,310,075 Y122C probably damaging Het
Olfr1335 T C 4: 118,809,238 M209V probably benign Het
Olfr339 C T 2: 36,421,643 L82F probably damaging Het
Olfr420 T A 1: 174,158,917 V48E possibly damaging Het
Olfr76 G T 19: 12,120,239 R158S possibly damaging Het
Olfr786 C T 10: 129,436,938 T42I probably damaging Het
Olfr877 T A 9: 37,855,252 L145M possibly damaging Het
Otog G T 7: 46,300,583 V2490F probably damaging Het
Pibf1 T C 14: 99,112,989 V191A probably benign Het
Pip A G 6: 41,849,918 M66V probably benign Het
Plxna2 C T 1: 194,767,463 R830C probably benign Het
Prkca A T 11: 107,939,520 V248E probably benign Het
Prmt7 T A 8: 106,237,284 L253* probably null Het
Prrc2a G T 17: 35,153,912 probably benign Het
Rasgrf1 A G 9: 90,012,800 D1091G probably benign Het
Rbm7 C A 9: 48,489,945 G161V probably benign Het
Scn1a A T 2: 66,322,429 I736N probably damaging Het
Skint6 A G 4: 112,869,524 probably benign Het
Slc22a2 C T 17: 12,584,308 H10Y possibly damaging Het
Sned1 G A 1: 93,281,654 V830M possibly damaging Het
Stam2 A G 2: 52,714,809 probably benign Het
Stk40 T C 4: 126,136,833 L282P probably damaging Het
Tas2r110 A G 6: 132,868,368 N121D probably damaging Het
Tbc1d32 A G 10: 56,017,662 Y1272H probably damaging Het
Tmem131l T C 3: 83,928,714 D696G probably damaging Het
Trdmt1 T C 2: 13,519,846 Y266C probably damaging Het
Trim5 G T 7: 104,279,519 H72N probably benign Het
Trim5 A C 7: 104,279,521 L71R probably benign Het
Twf2 T A 9: 106,214,813 probably benign Het
Ubap2l T C 3: 90,019,328 T580A probably benign Het
Ugt1a10 C T 1: 88,216,260 R201C probably damaging Het
Unc5a A G 13: 55,004,472 probably benign Het
Vmn2r85 T C 10: 130,425,286 N394S possibly damaging Het
Wrn A T 8: 33,319,141 probably benign Het
Other mutations in Hells
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02416:Hells APN 19 38964627 missense probably benign
IGL02639:Hells APN 19 38938429 missense probably damaging 0.99
cerberus UTSW 19 38954800 missense probably benign 0.00
charon UTSW 19 38954810 missense probably benign 0.15
intentions UTSW 19 38957199 missense probably damaging 1.00
purgatory UTSW 19 38940635 missense probably benign 0.08
R0543:Hells UTSW 19 38967750 missense probably benign
R1515:Hells UTSW 19 38967765 missense probably damaging 1.00
R1646:Hells UTSW 19 38967783 missense probably benign 0.19
R1779:Hells UTSW 19 38946842 missense probably benign 0.43
R1851:Hells UTSW 19 38959676 missense probably null 1.00
R1897:Hells UTSW 19 38940484 missense probably benign
R2040:Hells UTSW 19 38955030 missense probably damaging 0.98
R2571:Hells UTSW 19 38959733 missense possibly damaging 0.67
R4475:Hells UTSW 19 38945529 missense probably damaging 1.00
R4763:Hells UTSW 19 38957199 missense probably damaging 1.00
R4948:Hells UTSW 19 38935522 missense probably damaging 1.00
R5087:Hells UTSW 19 38943745 missense probably benign
R5517:Hells UTSW 19 38954800 missense probably benign 0.00
R5538:Hells UTSW 19 38953652 missense probably benign 0.00
R6107:Hells UTSW 19 38953649 missense probably benign 0.00
R6337:Hells UTSW 19 38954810 missense probably benign 0.15
R6577:Hells UTSW 19 38931465 nonsense probably null
R6618:Hells UTSW 19 38957084 missense probably benign 0.17
R6647:Hells UTSW 19 38931504 missense probably benign 0.01
R6869:Hells UTSW 19 38940635 missense probably benign 0.08
R7471:Hells UTSW 19 38957057 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GTTGAACTGTTAAGgttgggtgtggtaa -3'
(R):5'- TCTGGGTGGAATAATAGCCAACTAGGAA -3'

Sequencing Primer
(F):5'- attgggaaatagaggcggg -3'
(R):5'- TCTCACAGCAGTGGTTAAGTAG -3'
Posted On2014-03-14