Mutagenetix > Incidental Mutations

Incidental Mutation 'R1387:Adamtsl1'

162411

Institutional Source

Beutler Lab

Gene Symbol

Adamtsl1

Ensembl Gene

ENSMUSG00000066113

Gene Name

ADAMTS-like 1

Synonyms

5930437A14Rik, 6720426B09Rik, punctin-1

MMRRC Submission

039449-MU

Accession Numbers

Genbank: NM_172542; MGI: 1924989; Ensembl: ENSMUST00000141889

Is this an essential gene?

Probably non essential (E-score: 0.159) question?

Stock #

R1387 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

85514172-86428385 bp(+) (GRCm38)

Type of Mutation

splice site

DNA Base Change (assembly)

T to C at 86374993 bp

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000119278 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000107178] [ENSMUST00000141889]

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000107177

Predicted Effect

probably benign
Transcript: ENSMUST00000107178

SMART Domains

Protein: ENSMUSP00000102796
Gene: ENSMUSG00000066113

Domain	Start	End	E-Value	Type
signal peptide	1	28	N/A	INTRINSIC
TSP1	36	82	8.95e-7	SMART
TSP1	301	360	4.35e-2	SMART
TSP1	362	421	2.05e-2	SMART
TSP1	422	476	3.99e-4	SMART
TSP1	508	567	6.39e-3	SMART
TSP1	593	650	7.86e-3	SMART
TSP1	652	712	3.78e-5	SMART
TSP1	715	772	2.66e-2	SMART
TSP1	774	833	1.62e-4	SMART
IGc2	873	937	4.19e-6	SMART
low complexity region	1123	1142	N/A	INTRINSIC
IGc2	1175	1240	1.31e-7	SMART
IGc2	1282	1351	7.81e-15	SMART
IGc2	1400	1467	2.39e-10	SMART
TSP1	1481	1537	2.12e-1	SMART
TSP1	1540	1599	1.74e-4	SMART
TSP1	1600	1658	8.2e0	SMART
TSP1	1660	1717	1.96e-1	SMART
Pfam:PLAC	1721	1751	1.4e-9	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000141889

SMART Domains

Protein: ENSMUSP00000119278
Gene: ENSMUSG00000066113

Domain	Start	End	E-Value	Type
signal peptide	1	28	N/A	INTRINSIC
TSP1	36	82	8.95e-7	SMART
TSP1	301	360	4.35e-2	SMART
TSP1	379	438	2.05e-2	SMART
TSP1	439	493	3.99e-4	SMART
TSP1	525	584	6.39e-3	SMART
TSP1	610	667	7.86e-3	SMART
TSP1	707	764	2.66e-2	SMART
TSP1	766	825	1.62e-4	SMART
IGc2	865	929	4.19e-6	SMART
low complexity region	1115	1134	N/A	INTRINSIC
IGc2	1167	1232	1.31e-7	SMART
IGc2	1274	1343	7.81e-15	SMART
IGc2	1392	1459	2.39e-10	SMART
TSP1	1473	1529	2.12e-1	SMART
TSP1	1532	1591	1.74e-4	SMART
TSP1	1592	1650	8.2e0	SMART
TSP1	1652	1709	1.96e-1	SMART
Pfam:PLAC	1712	1744	5.6e-12	PFAM

Coding Region Coverage

1x: 98.9%
3x: 97.9%
10x: 95.1%
20x: 88.4%

Validation Efficiency

99% (82/83)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a secreted protein and member of the ADAMTS (a disintegrin and metalloproteinase with thrombospondin motif) family. This protein lacks the metalloproteinase and disintegrin-like domains, which are typical of the ADAMTS family, but contains other ADAMTS domains, including the thrombospondin type 1 motif. This protein may have important functions in the extracellular matrix. Alternative splicing results in multiple transcript variants encoding distinct proteins. [provided by RefSeq, Jul 2008]

Allele List at MGI

All alleles(3) : Gene trapped(3)

Other mutations in this stock

Total: 79 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2610303G11Rik	T	A	9: 98,186,759		noncoding transcript	Het
4930447C04Rik	C	A	12: 72,915,434	R52L	probably benign	Het
9930021J03Rik	A	G	19: 29,723,453	I812T	probably benign	Het
Abca13	C	T	11: 9,682,085	Q5002*	probably null	Het
Acacb	T	C	5: 114,200,512	I761T	probably benign	Het
Acap3	G	T	4: 155,899,480	L134F	probably benign	Het
Adgrv1	A	G	13: 81,493,176	V3278A	possibly damaging	Het
Agxt2	T	C	15: 10,380,610	Y196H	probably damaging	Het
Akap13	T	C	7: 75,586,193	V172A	probably damaging	Het
Aqp8	A	G	7: 123,466,668	I229V	probably benign	Het
Atp8a2	T	C	14: 59,860,270	K770E	probably benign	Het
Cacng8	T	C	7: 3,415,156	S275P	possibly damaging	Het
Catsperg1	T	C	7: 29,206,864	Y138C	probably damaging	Het
Ccdc93	T	G	1: 121,491,189	L491R	probably damaging	Het
Cntnap2	T	C	6: 47,107,914	V1103A	probably benign	Het
Col12a1	C	T	9: 79,681,375		probably benign	Het
Col6a3	A	G	1: 90,822,416		probably benign	Het
Csf2rb2	C	T	15: 78,298,214	A6T	probably damaging	Het
Cyp2j5	T	A	4: 96,634,285	S351C	probably damaging	Het
Cyth1	A	G	11: 118,182,346		probably benign	Het
Dock2	A	G	11: 34,273,309		probably benign	Het
Duoxa1	T	A	2: 122,303,987	I262F	possibly damaging	Het
Dync2h1	T	C	9: 7,125,816	D1930G	probably benign	Het
Elmsan1	C	A	12: 84,152,931	R1005L	probably damaging	Het
Eno1	C	T	4: 150,248,133		probably benign	Het
Fam102a	T	C	2: 32,565,623	S254P	possibly damaging	Het
Fam98a	T	A	17: 75,538,269	H494L	unknown	Het
Fcamr	C	A	1: 130,804,642	T122K	possibly damaging	Het
Foxq1	A	G	13: 31,559,305	D130G	probably damaging	Het
Glb1	T	A	9: 114,420,363	W5R	probably damaging	Het
Gm17661	GA	GAA	2: 90,917,709		noncoding transcript	Het
Gm5431	T	A	11: 48,895,015	R178W	possibly damaging	Het
Gys2	C	T	6: 142,461,283	V116M	probably benign	Het
Hif1a	C	T	12: 73,942,292	T651I	possibly damaging	Het
Itgb5	T	A	16: 33,900,515	Y3*	probably null	Het
Kank3	A	G	17: 33,816,231	N7S	possibly damaging	Het
Kdm2b	G	T	5: 122,880,268	H981Q	probably damaging	Het
Kdm6a	C	T	X: 18,253,996		probably benign	Het
Kif1a	A	T	1: 93,055,950		probably benign	Het
Knl1	T	A	2: 119,070,730	S971T	possibly damaging	Het
Lcn6	T	C	2: 25,677,137	V50A	possibly damaging	Het
Llgl2	G	T	11: 115,853,132	V762F	probably damaging	Het
Lpcat4	T	C	2: 112,244,676	F342L	probably benign	Het
Lrp2	C	A	2: 69,456,918	G3725V	probably damaging	Het
Map1b	T	C	13: 99,432,650	T1188A	unknown	Het
Mecp2	G	A	X: 74,035,788	P362S	possibly damaging	Het
Mmp13	T	A	9: 7,282,033	F445Y	possibly damaging	Het
Myo5b	G	T	18: 74,644,201		probably benign	Het
Myo7b	A	G	18: 31,983,752		probably benign	Het
Nadk2	C	A	15: 9,106,782	L384I	possibly damaging	Het
Napg	A	G	18: 62,986,212	I98V	possibly damaging	Het
Ncoa1	G	T	12: 4,274,790	N1041K	probably benign	Het
Nmu	A	T	5: 76,350,145	C64*	probably null	Het
Nobox	T	A	6: 43,307,198	K13M	probably damaging	Het
Nos1	T	C	5: 117,953,783		probably benign	Het
Nrg2	A	G	18: 36,196,739	V141A	probably damaging	Het
Olfr170	T	C	16: 19,606,027	I214V	probably damaging	Het
Olfr362	T	G	2: 37,104,868	I261L	probably benign	Het
Olfr544	T	A	7: 102,484,704	I139L	probably benign	Het
Phldb2	C	T	16: 45,825,994	E71K	possibly damaging	Het
Pik3r4	T	A	9: 105,644,291	Y19N	probably damaging	Het
Pkhd1	A	C	1: 20,555,223		probably benign	Het
Pogk	G	T	1: 166,400,138	P148Q	possibly damaging	Het
Pten	G	T	19: 32,798,096	A79S	probably benign	Het
Ptpdc1	A	T	13: 48,586,320	V545E	possibly damaging	Het
Qdpr	G	C	5: 45,450,138		probably benign	Het
Rhbdd3	T	A	11: 5,104,121	H83Q	probably damaging	Het
Rnf6	A	G	5: 146,211,245	V321A	probably benign	Het
Rtf1	T	A	2: 119,705,645		probably null	Het
Serpina10	C	T	12: 103,628,241	V240I	probably benign	Het
Siah2	A	G	3: 58,691,514	V101A	possibly damaging	Het
Taok3	A	G	5: 117,206,655	K46R	probably damaging	Het
Tcaf2	A	C	6: 42,624,578	L849R	probably damaging	Het
Upf3a	T	C	8: 13,792,118	F178S	probably damaging	Het
Vmn1r218	G	A	13: 23,137,308	G195D	probably damaging	Het
Vmn2r59	A	G	7: 42,046,097	V297A	probably damaging	Het
Vmn2r70	T	A	7: 85,558,761	Q836L	probably benign	Het
Zfp473	A	G	7: 44,732,941	V655A	probably benign	Het
Zic5	A	G	14: 122,459,485	S573P	unknown	Het

Other mutations in Adamtsl1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00231:Adamtsl1	APN	4	86385640	missense	probably benign	0.01
IGL00741:Adamtsl1	APN	4	86276948	missense	probably damaging	1.00
IGL00770:Adamtsl1	APN	4	86388539	missense	possibly damaging	0.65
IGL00774:Adamtsl1	APN	4	86388539	missense	possibly damaging	0.65
IGL00826:Adamtsl1	APN	4	86156804	missense	probably damaging	1.00
IGL00938:Adamtsl1	APN	4	86342278	missense	possibly damaging	0.93
IGL01012:Adamtsl1	APN	4	86342189	missense	possibly damaging	0.93
IGL01728:Adamtsl1	APN	4	86110837	missense	probably damaging	1.00
IGL01801:Adamtsl1	APN	4	86199322	missense	probably benign	0.23
IGL01922:Adamtsl1	APN	4	86249902	missense	probably damaging	1.00
IGL02006:Adamtsl1	APN	4	86199345	missense	probably damaging	1.00
IGL02192:Adamtsl1	APN	4	86228016	missense	probably damaging	1.00
IGL02351:Adamtsl1	APN	4	86156873	critical splice donor site	probably null
IGL02358:Adamtsl1	APN	4	86156873	critical splice donor site	probably null
IGL02373:Adamtsl1	APN	4	86249805	missense	probably damaging	1.00
IGL02660:Adamtsl1	APN	4	86232610	missense	probably damaging	1.00
IGL02964:Adamtsl1	APN	4	86424357	missense	probably damaging	1.00
IGL03233:Adamtsl1	APN	4	86342120	missense	probably damaging	1.00
IGL03297:Adamtsl1	APN	4	86423426	missense	probably damaging	0.98
IGL03326:Adamtsl1	APN	4	86252748	splice site	probably benign
PIT4378001:Adamtsl1	UTSW	4	86199364	missense	possibly damaging	0.93
PIT4418001:Adamtsl1	UTSW	4	86243724	missense	probably damaging	1.00
R0131:Adamtsl1	UTSW	4	86342723	missense	possibly damaging	0.94
R0131:Adamtsl1	UTSW	4	86342723	missense	possibly damaging	0.94
R0132:Adamtsl1	UTSW	4	86342723	missense	possibly damaging	0.94
R0453:Adamtsl1	UTSW	4	86232615	missense	probably damaging	1.00
R0480:Adamtsl1	UTSW	4	86252818	missense	probably benign	0.08
R0496:Adamtsl1	UTSW	4	86341198	missense	probably damaging	1.00
R0538:Adamtsl1	UTSW	4	86343121	missense	probably benign	0.27
R0547:Adamtsl1	UTSW	4	86356355	missense	probably benign	0.37
R0567:Adamtsl1	UTSW	4	86228016	missense	probably damaging	1.00
R0568:Adamtsl1	UTSW	4	86418552	missense	probably damaging	1.00
R0639:Adamtsl1	UTSW	4	86277143	missense	probably damaging	1.00
R0931:Adamtsl1	UTSW	4	86249847	missense	probably benign	0.05
R1186:Adamtsl1	UTSW	4	86388509	missense	probably benign	0.00
R1459:Adamtsl1	UTSW	4	86425865	missense	probably damaging	1.00
R1518:Adamtsl1	UTSW	4	86342603	missense	probably damaging	0.99
R1532:Adamtsl1	UTSW	4	86248065	missense	probably benign	0.02
R1603:Adamtsl1	UTSW	4	86415530	missense	probably benign
R1931:Adamtsl1	UTSW	4	86342411	missense	possibly damaging	0.62
R2086:Adamtsl1	UTSW	4	86228012	missense	probably damaging	1.00
R2221:Adamtsl1	UTSW	4	86388525	missense	probably benign	0.19
R2223:Adamtsl1	UTSW	4	86388525	missense	probably benign	0.19
R2396:Adamtsl1	UTSW	4	86343119	nonsense	probably null
R2397:Adamtsl1	UTSW	4	86199357	missense	probably damaging	1.00
R2426:Adamtsl1	UTSW	4	86156788	missense	probably benign	0.01
R3121:Adamtsl1	UTSW	4	86337009	missense	probably damaging	1.00
R3715:Adamtsl1	UTSW	4	86216976	missense	probably benign	0.01
R3848:Adamtsl1	UTSW	4	86418546	missense	probably damaging	1.00
R3849:Adamtsl1	UTSW	4	86418546	missense	probably damaging	1.00
R3850:Adamtsl1	UTSW	4	86418546	missense	probably damaging	1.00
R4194:Adamtsl1	UTSW	4	86054008	intron	probably benign
R4354:Adamtsl1	UTSW	4	86156684	missense	probably damaging	1.00
R4795:Adamtsl1	UTSW	4	86243769	critical splice donor site	probably null
R4830:Adamtsl1	UTSW	4	86356382	missense	probably damaging	0.97
R4874:Adamtsl1	UTSW	4	86342492	missense	possibly damaging	0.94
R4939:Adamtsl1	UTSW	4	86243725	missense	possibly damaging	0.95
R4942:Adamtsl1	UTSW	4	86341214	nonsense	probably null
R4947:Adamtsl1	UTSW	4	85764800	missense	possibly damaging	0.93
R4960:Adamtsl1	UTSW	4	86424173	nonsense	probably null
R4971:Adamtsl1	UTSW	4	86336931	missense	probably damaging	1.00
R5141:Adamtsl1	UTSW	4	86156850	missense	possibly damaging	0.77
R5213:Adamtsl1	UTSW	4	86385628	missense	possibly damaging	0.89
R5237:Adamtsl1	UTSW	4	86385669	critical splice donor site	probably null
R5250:Adamtsl1	UTSW	4	86216945	nonsense	probably null
R5411:Adamtsl1	UTSW	4	86388413	critical splice acceptor site	probably null
R5554:Adamtsl1	UTSW	4	86276945	missense	possibly damaging	0.69
R5631:Adamtsl1	UTSW	4	86276923	nonsense	probably null
R5739:Adamtsl1	UTSW	4	86232664	missense	probably damaging	1.00
R5905:Adamtsl1	UTSW	4	86342324	missense	probably damaging	1.00
R6028:Adamtsl1	UTSW	4	86342324	missense	probably damaging	1.00
R6044:Adamtsl1	UTSW	4	86212691	missense	probably damaging	1.00
R6261:Adamtsl1	UTSW	4	86336878	missense	probably benign	0.09
R6300:Adamtsl1	UTSW	4	86248017	missense	probably damaging	1.00
R6332:Adamtsl1	UTSW	4	86217011	missense	probably damaging	0.96
R6560:Adamtsl1	UTSW	4	86336893	missense	probably damaging	1.00
R6693:Adamtsl1	UTSW	4	86342886	missense	probably benign	0.27
R6736:Adamtsl1	UTSW	4	86342247	missense	probably damaging	1.00
R6964:Adamtsl1	UTSW	4	86156854	missense	probably damaging	1.00
R7064:Adamtsl1	UTSW	4	86342041	missense	possibly damaging	0.80
R7434:Adamtsl1	UTSW	4	86425878	missense	probably damaging	0.99
R7477:Adamtsl1	UTSW	4	86415651	missense	probably damaging	1.00
R7545:Adamtsl1	UTSW	4	85764855	missense	probably damaging	1.00
R7556:Adamtsl1	UTSW	4	86277121	missense	probably benign	0.19
R7580:Adamtsl1	UTSW	4	86054064	missense	possibly damaging	0.53
R7593:Adamtsl1	UTSW	4	86341213	missense	probably damaging	1.00
R7710:Adamtsl1	UTSW	4	86232573	missense	not run

Predicted Primers

PCR Primer
(F):5'- AGTTTCTCCTCCAGGCAAAACATGG -3'
(R):5'- TAGCGCCTCCTTTAGTCTACCAGG -3'

Sequencing Primer
(F):5'- CGATGTTGTTGATGAGAGATCAC -3'
(R):5'- CTCCTTTAGTCTACCAGGCTTAG -3'

Posted On

2014-03-17