Mutagenetix > Incidental Mutation

Incidental Mutation 'R1387:Acacb'

162416

Institutional Source

Beutler Lab

Gene Symbol

Acacb

Ensembl Gene

ENSMUSG00000042010

Gene Name

acetyl-Coenzyme A carboxylase beta

Synonyms

Acc2, Accb

MMRRC Submission

039449-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1387 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

114146535-114250761 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 114200512 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Threonine at position 761 (I761T)

Ref Sequence

ENSEMBL: ENSMUSP00000099642 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000031583] [ENSMUST00000102582]

AlphaFold

E9Q4Z2

Predicted Effect

probably benign
Transcript: ENSMUST00000031583
AA Change: I761T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000031583
Gene: ENSMUSG00000042010
AA Change: I761T

Domain	Start	End	E-Value	Type
signal peptide	1	16	N/A	INTRINSIC
low complexity region	38	60	N/A	INTRINSIC
Pfam:CPSase_L_chain	249	369	2.1e-32	PFAM
Pfam:CPSase_L_D2	405	606	3.3e-52	PFAM
Pfam:ATP-grasp_4	413	576	2.1e-9	PFAM
Biotin_carb_C	640	747	9.54e-26	SMART
Pfam:Biotin_lipoyl	885	951	1.9e-17	PFAM
Pfam:ACC_central	952	1678	2.2e-290	PFAM
Pfam:Carboxyl_trans	1770	2324	2.3e-181	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000102582
AA Change: I761T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000099642
Gene: ENSMUSG00000042010
AA Change: I761T

Domain	Start	End	E-Value	Type
signal peptide	1	16	N/A	INTRINSIC
low complexity region	38	60	N/A	INTRINSIC
Pfam:CPSase_L_chain	249	369	8.2e-29	PFAM
Pfam:CPSase_L_D2	405	606	3.8e-52	PFAM
Pfam:ATP-grasp_4	409	576	1.4e-12	PFAM
Biotin_carb_C	640	747	9.54e-26	SMART
Pfam:Biotin_lipoyl	885	951	9.1e-17	PFAM
Pfam:ACC_central	952	1678	2.3e-250	PFAM
Pfam:Carboxyl_trans	1770	2324	4.8e-172	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000143276

Meta Mutation Damage Score

0.0708

Coding Region Coverage

1x: 98.9%
3x: 97.9%
10x: 95.1%
20x: 88.4%

Validation Efficiency

99% (82/83)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Acetyl-CoA carboxylase (ACC) is a complex multifunctional enzyme system. ACC is a biotin-containing enzyme which catalyzes the carboxylation of acetyl-CoA to malonyl-CoA, the rate-limiting step in fatty acid synthesis. ACC-beta is thought to control fatty acid oxidation by means of the ability of malonyl-CoA to inhibit carnitine-palmitoyl-CoA transferase I, the rate-limiting step in fatty acid uptake and oxidation by mitochondria. ACC-beta may be involved in the regulation of fatty acid oxidation, rather than fatty acid biosynthesis. There is evidence for the presence of two ACC-beta isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a targeted null mutation are viable, fertile and overtly normal but exhibit high levels of fatty acid oxidation, as well as reduced fat accumulation in their adipose tissue and liver, and decreased storage of glycogen in their liver. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 79 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2610303G11Rik	T	A	9: 98,186,759		noncoding transcript	Het
4930447C04Rik	C	A	12: 72,915,434	R52L	probably benign	Het
9930021J03Rik	A	G	19: 29,723,453	I812T	probably benign	Het
Abca13	C	T	11: 9,682,085	Q5002*	probably null	Het
Acap3	G	T	4: 155,899,480	L134F	probably benign	Het
Adamtsl1	T	C	4: 86,374,993		probably benign	Het
Adgrv1	A	G	13: 81,493,176	V3278A	possibly damaging	Het
Agxt2	T	C	15: 10,380,610	Y196H	probably damaging	Het
Akap13	T	C	7: 75,586,193	V172A	probably damaging	Het
Aqp8	A	G	7: 123,466,668	I229V	probably benign	Het
Atp8a2	T	C	14: 59,860,270	K770E	probably benign	Het
Cacng8	T	C	7: 3,415,156	S275P	possibly damaging	Het
Catsperg1	T	C	7: 29,206,864	Y138C	probably damaging	Het
Ccdc93	T	G	1: 121,491,189	L491R	probably damaging	Het
Cntnap2	T	C	6: 47,107,914	V1103A	probably benign	Het
Col12a1	C	T	9: 79,681,375		probably benign	Het
Col6a3	A	G	1: 90,822,416		probably benign	Het
Csf2rb2	C	T	15: 78,298,214	A6T	probably damaging	Het
Cyp2j5	T	A	4: 96,634,285	S351C	probably damaging	Het
Cyth1	A	G	11: 118,182,346		probably benign	Het
Dock2	A	G	11: 34,273,309		probably benign	Het
Duoxa1	T	A	2: 122,303,987	I262F	possibly damaging	Het
Dync2h1	T	C	9: 7,125,816	D1930G	probably benign	Het
Elmsan1	C	A	12: 84,152,931	R1005L	probably damaging	Het
Eno1	C	T	4: 150,248,133		probably benign	Het
Fam102a	T	C	2: 32,565,623	S254P	possibly damaging	Het
Fam98a	T	A	17: 75,538,269	H494L	unknown	Het
Fcamr	C	A	1: 130,804,642	T122K	possibly damaging	Het
Foxq1	A	G	13: 31,559,305	D130G	probably damaging	Het
Glb1	T	A	9: 114,420,363	W5R	probably damaging	Het
Gm17661	GA	GAA	2: 90,917,709		noncoding transcript	Het
Gm5431	T	A	11: 48,895,015	R178W	possibly damaging	Het
Gys2	C	T	6: 142,461,283	V116M	probably benign	Het
Hif1a	C	T	12: 73,942,292	T651I	possibly damaging	Het
Itgb5	T	A	16: 33,900,515	Y3*	probably null	Het
Kank3	A	G	17: 33,816,231	N7S	possibly damaging	Het
Kdm2b	G	T	5: 122,880,268	H981Q	probably damaging	Het
Kdm6a	C	T	X: 18,253,996		probably benign	Het
Kif1a	A	T	1: 93,055,950		probably benign	Het
Knl1	T	A	2: 119,070,730	S971T	possibly damaging	Het
Lcn6	T	C	2: 25,677,137	V50A	possibly damaging	Het
Llgl2	G	T	11: 115,853,132	V762F	probably damaging	Het
Lpcat4	T	C	2: 112,244,676	F342L	probably benign	Het
Lrp2	C	A	2: 69,456,918	G3725V	probably damaging	Het
Map1b	T	C	13: 99,432,650	T1188A	unknown	Het
Mecp2	G	A	X: 74,035,788	P362S	possibly damaging	Het
Mmp13	T	A	9: 7,282,033	F445Y	possibly damaging	Het
Myo5b	G	T	18: 74,644,201		probably benign	Het
Myo7b	A	G	18: 31,983,752		probably benign	Het
Nadk2	C	A	15: 9,106,782	L384I	possibly damaging	Het
Napg	A	G	18: 62,986,212	I98V	possibly damaging	Het
Ncoa1	G	T	12: 4,274,790	N1041K	probably benign	Het
Nmu	A	T	5: 76,350,145	C64*	probably null	Het
Nobox	T	A	6: 43,307,198	K13M	probably damaging	Het
Nos1	T	C	5: 117,953,783		probably benign	Het
Nrg2	A	G	18: 36,196,739	V141A	probably damaging	Het
Olfr170	T	C	16: 19,606,027	I214V	probably damaging	Het
Olfr362	T	G	2: 37,104,868	I261L	probably benign	Het
Olfr544	T	A	7: 102,484,704	I139L	probably benign	Het
Phldb2	C	T	16: 45,825,994	E71K	possibly damaging	Het
Pik3r4	T	A	9: 105,644,291	Y19N	probably damaging	Het
Pkhd1	A	C	1: 20,555,223		probably benign	Het
Pogk	G	T	1: 166,400,138	P148Q	possibly damaging	Het
Pten	G	T	19: 32,798,096	A79S	probably benign	Het
Ptpdc1	A	T	13: 48,586,320	V545E	possibly damaging	Het
Qdpr	G	C	5: 45,450,138		probably benign	Het
Rhbdd3	T	A	11: 5,104,121	H83Q	probably damaging	Het
Rnf6	A	G	5: 146,211,245	V321A	probably benign	Het
Rtf1	T	A	2: 119,705,645		probably null	Het
Serpina10	C	T	12: 103,628,241	V240I	probably benign	Het
Siah2	A	G	3: 58,691,514	V101A	possibly damaging	Het
Taok3	A	G	5: 117,206,655	K46R	probably damaging	Het
Tcaf2	A	C	6: 42,624,578	L849R	probably damaging	Het
Upf3a	T	C	8: 13,792,118	F178S	probably damaging	Het
Vmn1r218	G	A	13: 23,137,308	G195D	probably damaging	Het
Vmn2r59	A	G	7: 42,046,097	V297A	probably damaging	Het
Vmn2r70	T	A	7: 85,558,761	Q836L	probably benign	Het
Zfp473	A	G	7: 44,732,941	V655A	probably benign	Het
Zic5	A	G	14: 122,459,485	S573P	unknown	Het

Other mutations in Acacb

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00482:Acacb	APN	5	114200289	missense	probably damaging	1.00
IGL01291:Acacb	APN	5	114225870	missense	probably benign	0.03
IGL01301:Acacb	APN	5	114246498	missense	probably benign
IGL01633:Acacb	APN	5	114218858	splice site	probably benign
IGL01736:Acacb	APN	5	114188442	missense	possibly damaging	0.96
IGL01782:Acacb	APN	5	114200520	missense	probably damaging	1.00
IGL01924:Acacb	APN	5	114223986	splice site	probably benign
IGL01933:Acacb	APN	5	114184190	splice site	probably benign
IGL02028:Acacb	APN	5	114166015	missense	probably damaging	1.00
IGL02045:Acacb	APN	5	114240660	missense	possibly damaging	0.95
IGL02346:Acacb	APN	5	114238699	missense	probably damaging	1.00
IGL02421:Acacb	APN	5	114223878	missense	probably benign	0.00
IGL02445:Acacb	APN	5	114245137	missense	probably damaging	1.00
IGL02491:Acacb	APN	5	114192105	missense	probably damaging	1.00
IGL02598:Acacb	APN	5	114246037	missense	probably damaging	1.00
IGL02700:Acacb	APN	5	114218881	missense	probably damaging	1.00
IGL02730:Acacb	APN	5	114166149	splice site	probably benign
IGL03110:Acacb	APN	5	114195234	missense	probably damaging	0.96
IGL03125:Acacb	APN	5	114204805	missense	possibly damaging	0.49
IGL03263:Acacb	APN	5	114213693	missense	probably damaging	1.00
IGL03324:Acacb	APN	5	114225854	nonsense	probably null
acetone	UTSW	5	114226857	nonsense	probably null
anabolism	UTSW	5	114245220	missense	possibly damaging	0.63
ANU05:Acacb	UTSW	5	114225870	missense	probably benign	0.03
ANU18:Acacb	UTSW	5	114246498	missense	probably benign
BB001:Acacb	UTSW	5	114245220	missense	possibly damaging	0.63
BB011:Acacb	UTSW	5	114245220	missense	possibly damaging	0.63
I0000:Acacb	UTSW	5	114238655	missense	probably damaging	0.99
R0001:Acacb	UTSW	5	114204833	splice site	probably benign
R0219:Acacb	UTSW	5	114232944	missense	possibly damaging	0.79
R0234:Acacb	UTSW	5	114209817	missense	probably damaging	0.99
R0234:Acacb	UTSW	5	114209817	missense	probably damaging	0.99
R0278:Acacb	UTSW	5	114233259	nonsense	probably null
R0607:Acacb	UTSW	5	114200301	missense	probably damaging	1.00
R0964:Acacb	UTSW	5	114229752	missense	possibly damaging	0.64
R1116:Acacb	UTSW	5	114210956	missense	probably damaging	1.00
R1196:Acacb	UTSW	5	114245092	missense	probably benign	0.00
R1204:Acacb	UTSW	5	114190153	missense	probably damaging	1.00
R1415:Acacb	UTSW	5	114165921	missense	probably benign
R1475:Acacb	UTSW	5	114195252	missense	possibly damaging	0.87
R1497:Acacb	UTSW	5	114196807	missense	probably damaging	1.00
R1520:Acacb	UTSW	5	114201940	missense	possibly damaging	0.67
R1591:Acacb	UTSW	5	114203423	missense	possibly damaging	0.87
R1644:Acacb	UTSW	5	114195285	missense	probably damaging	1.00
R1732:Acacb	UTSW	5	114190087	missense	possibly damaging	0.63
R1783:Acacb	UTSW	5	114209767	frame shift	probably null
R1784:Acacb	UTSW	5	114209767	frame shift	probably null
R1834:Acacb	UTSW	5	114235475	missense	probably damaging	1.00
R1858:Acacb	UTSW	5	114196709	missense	probably benign	0.13
R1886:Acacb	UTSW	5	114218959	missense	probably damaging	1.00
R1901:Acacb	UTSW	5	114165734	nonsense	probably null
R1902:Acacb	UTSW	5	114165734	nonsense	probably null
R1903:Acacb	UTSW	5	114165734	nonsense	probably null
R1924:Acacb	UTSW	5	114230720	missense	possibly damaging	0.67
R1934:Acacb	UTSW	5	114198282	missense	probably benign	0.27
R2051:Acacb	UTSW	5	114245890	missense	probably damaging	1.00
R2132:Acacb	UTSW	5	114209767	frame shift	probably null
R2133:Acacb	UTSW	5	114209767	frame shift	probably null
R2260:Acacb	UTSW	5	114216917	missense	probably damaging	0.99
R2967:Acacb	UTSW	5	114166070	missense	possibly damaging	0.81
R3421:Acacb	UTSW	5	114212636	splice site	probably null
R3729:Acacb	UTSW	5	114207348	missense	probably damaging	0.99
R4206:Acacb	UTSW	5	114213651	missense	probably benign
R4245:Acacb	UTSW	5	114230784	missense	probably damaging	0.97
R4386:Acacb	UTSW	5	114241921	critical splice acceptor site	probably null
R4439:Acacb	UTSW	5	114246496	missense	possibly damaging	0.50
R4577:Acacb	UTSW	5	114226831	missense	probably damaging	1.00
R4658:Acacb	UTSW	5	114200564	missense	probably damaging	0.96
R4688:Acacb	UTSW	5	114204763	missense	probably benign	0.01
R4720:Acacb	UTSW	5	114229914	missense	possibly damaging	0.73
R4898:Acacb	UTSW	5	114232938	missense	probably benign	0.04
R5044:Acacb	UTSW	5	114166027	missense	probably benign	0.03
R5070:Acacb	UTSW	5	114246028	missense	possibly damaging	0.46
R5294:Acacb	UTSW	5	114241952	missense	probably damaging	1.00
R5350:Acacb	UTSW	5	114244551	missense	probably damaging	1.00
R5401:Acacb	UTSW	5	114209853	missense	possibly damaging	0.80
R5531:Acacb	UTSW	5	114204706	missense	possibly damaging	0.92
R5542:Acacb	UTSW	5	114195737	missense	probably damaging	1.00
R5751:Acacb	UTSW	5	114230832	missense	possibly damaging	0.79
R5821:Acacb	UTSW	5	114184106	missense	possibly damaging	0.69
R5893:Acacb	UTSW	5	114229851	missense	probably benign	0.01
R5911:Acacb	UTSW	5	114232890	missense	probably damaging	0.97
R5944:Acacb	UTSW	5	114245980	missense	probably damaging	1.00
R5973:Acacb	UTSW	5	114226867	missense	probably damaging	1.00
R6027:Acacb	UTSW	5	114165600	missense	probably benign	0.43
R6103:Acacb	UTSW	5	114245881	missense	probably damaging	1.00
R6139:Acacb	UTSW	5	114212652	missense	probably damaging	1.00
R6292:Acacb	UTSW	5	114200251	missense	probably damaging	1.00
R6368:Acacb	UTSW	5	114216823	missense	probably damaging	0.98
R6429:Acacb	UTSW	5	114228591	missense	probably damaging	1.00
R6942:Acacb	UTSW	5	114191963	critical splice donor site	probably null
R7138:Acacb	UTSW	5	114207326	missense	probably benign	0.12
R7241:Acacb	UTSW	5	114245100	missense	possibly damaging	0.94
R7254:Acacb	UTSW	5	114209751	critical splice acceptor site	probably null
R7396:Acacb	UTSW	5	114213661	missense	possibly damaging	0.87
R7439:Acacb	UTSW	5	114195642	missense	possibly damaging	0.84
R7484:Acacb	UTSW	5	114218862	missense	probably damaging	1.00
R7585:Acacb	UTSW	5	114246012	missense	probably damaging	0.99
R7712:Acacb	UTSW	5	114165738	missense	probably benign	0.13
R7868:Acacb	UTSW	5	114248227	missense	probably benign	0.22
R7873:Acacb	UTSW	5	114223278	missense	possibly damaging	0.88
R7924:Acacb	UTSW	5	114245220	missense	possibly damaging	0.63
R7940:Acacb	UTSW	5	114166047	missense	possibly damaging	0.77
R7951:Acacb	UTSW	5	114188340	missense	probably damaging	1.00
R7960:Acacb	UTSW	5	114230861	missense	probably benign	0.00
R7972:Acacb	UTSW	5	114226857	nonsense	probably null
R8007:Acacb	UTSW	5	114218874	missense	probably damaging	0.97
R8022:Acacb	UTSW	5	114223854	missense	probably benign
R8030:Acacb	UTSW	5	114233167	missense	probably damaging	1.00
R8241:Acacb	UTSW	5	114195236	missense	possibly damaging	0.49
R8264:Acacb	UTSW	5	114207366	missense	probably benign	0.00
R8292:Acacb	UTSW	5	114200494	critical splice acceptor site	probably null
R8678:Acacb	UTSW	5	114201971	nonsense	probably null
R8693:Acacb	UTSW	5	114226783	missense	probably damaging	0.99
R8697:Acacb	UTSW	5	114213380	missense	probably damaging	0.96
R8772:Acacb	UTSW	5	114184118	missense	possibly damaging	0.73
R8918:Acacb	UTSW	5	114195254	missense	probably damaging	1.00
R9008:Acacb	UTSW	5	114248754	splice site	silent
R9044:Acacb	UTSW	5	114235517	missense	probably benign	0.00
R9165:Acacb	UTSW	5	114216683	missense	probably benign	0.01
R9231:Acacb	UTSW	5	114211092	missense	probably benign	0.01
R9440:Acacb	UTSW	5	114246024	missense	possibly damaging	0.56
R9444:Acacb	UTSW	5	114245959	missense	probably damaging	0.99
R9562:Acacb	UTSW	5	114233336	missense	probably damaging	0.99
R9794:Acacb	UTSW	5	114249517	missense	probably benign	0.00
V1662:Acacb	UTSW	5	114238708	missense	probably damaging	1.00
Z1176:Acacb	UTSW	5	114248948	missense	probably benign	0.02

Predicted Primers

PCR Primer
(F):5'- ACGTGGAAACCAGTCCTGTGTCTC -3'
(R):5'- AGCAAAAGCCTCATTCTGCCTGCC -3'

Sequencing Primer
(F):5'- TTGAAGGAACTGTCCATCCG -3'
(R):5'- GCCTGCCTTCCATGCTG -3'

Posted On

2014-03-17