Incidental Mutation 'R1387:Pten'
ID162469
Institutional Source Beutler Lab
Gene Symbol Pten
Ensembl Gene ENSMUSG00000013663
Gene Namephosphatase and tensin homolog
SynonymsA130070J02Rik, 2310035O07Rik, B430203M17Rik, MMAC1, TEP1
MMRRC Submission 039449-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1387 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location32757497-32826160 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 32798096 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Serine at position 79 (A79S)
Ref Sequence ENSEMBL: ENSMUSP00000013807 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000013807]
Predicted Effect probably benign
Transcript: ENSMUST00000013807
AA Change: A79S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000013807
Gene: ENSMUSG00000013663
AA Change: A79S

DomainStartEndE-ValueType
Pfam:Y_phosphatase 42 183 2.7e-6 PFAM
Pfam:DSPc 67 173 2.4e-9 PFAM
PTEN_C2 188 349 4.07e-49 SMART
low complexity region 360 371 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140014
Meta Mutation Damage Score 0.0712 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 95.1%
  • 20x: 88.4%
Validation Efficiency 99% (82/83)
MGI Phenotype FUNCTION: This gene encodes a phosphatase with dual activity against phospholipids and proteins, and acts as a tumor-suppressor. The protein contains four structural domains, a PIP2-binding domain, a catalytic tensin-type phosphatase domain, a C2 tensin-type domain and a PDZ-binding domain. The protein belongs to the protein tyrosine phosphatase family. Deletion of this gene in mice contribute to tumorigenesis in multiple tissues. [provided by RefSeq, Sep 2015]
PHENOTYPE: Homozygous null mutants die by E9.5 with abnormally patterned enlarged brains and defective placentas. Heterozygotes develop a range of neoplasms. Conditional mutants demonstrate effects on basic processes of proliferation, differentiation and apoptosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610303G11Rik T A 9: 98,186,759 noncoding transcript Het
4930447C04Rik C A 12: 72,915,434 R52L probably benign Het
9930021J03Rik A G 19: 29,723,453 I812T probably benign Het
Abca13 C T 11: 9,682,085 Q5002* probably null Het
Acacb T C 5: 114,200,512 I761T probably benign Het
Acap3 G T 4: 155,899,480 L134F probably benign Het
Adamtsl1 T C 4: 86,374,993 probably benign Het
Adgrv1 A G 13: 81,493,176 V3278A possibly damaging Het
Agxt2 T C 15: 10,380,610 Y196H probably damaging Het
Akap13 T C 7: 75,586,193 V172A probably damaging Het
Aqp8 A G 7: 123,466,668 I229V probably benign Het
Atp8a2 T C 14: 59,860,270 K770E probably benign Het
Cacng8 T C 7: 3,415,156 S275P possibly damaging Het
Catsperg1 T C 7: 29,206,864 Y138C probably damaging Het
Ccdc93 T G 1: 121,491,189 L491R probably damaging Het
Cntnap2 T C 6: 47,107,914 V1103A probably benign Het
Col12a1 C T 9: 79,681,375 probably benign Het
Col6a3 A G 1: 90,822,416 probably benign Het
Csf2rb2 C T 15: 78,298,214 A6T probably damaging Het
Cyp2j5 T A 4: 96,634,285 S351C probably damaging Het
Cyth1 A G 11: 118,182,346 probably benign Het
Dock2 A G 11: 34,273,309 probably benign Het
Duoxa1 T A 2: 122,303,987 I262F possibly damaging Het
Dync2h1 T C 9: 7,125,816 D1930G probably benign Het
Elmsan1 C A 12: 84,152,931 R1005L probably damaging Het
Eno1 C T 4: 150,248,133 probably benign Het
Fam102a T C 2: 32,565,623 S254P possibly damaging Het
Fam98a T A 17: 75,538,269 H494L unknown Het
Fcamr C A 1: 130,804,642 T122K possibly damaging Het
Foxq1 A G 13: 31,559,305 D130G probably damaging Het
Glb1 T A 9: 114,420,363 W5R probably damaging Het
Gm17661 GA GAA 2: 90,917,709 noncoding transcript Het
Gm5431 T A 11: 48,895,015 R178W possibly damaging Het
Gys2 C T 6: 142,461,283 V116M probably benign Het
Hif1a C T 12: 73,942,292 T651I possibly damaging Het
Itgb5 T A 16: 33,900,515 Y3* probably null Het
Kank3 A G 17: 33,816,231 N7S possibly damaging Het
Kdm2b G T 5: 122,880,268 H981Q probably damaging Het
Kdm6a C T X: 18,253,996 probably benign Het
Kif1a A T 1: 93,055,950 probably benign Het
Knl1 T A 2: 119,070,730 S971T possibly damaging Het
Lcn6 T C 2: 25,677,137 V50A possibly damaging Het
Llgl2 G T 11: 115,853,132 V762F probably damaging Het
Lpcat4 T C 2: 112,244,676 F342L probably benign Het
Lrp2 C A 2: 69,456,918 G3725V probably damaging Het
Map1b T C 13: 99,432,650 T1188A unknown Het
Mecp2 G A X: 74,035,788 P362S possibly damaging Het
Mmp13 T A 9: 7,282,033 F445Y possibly damaging Het
Myo5b G T 18: 74,644,201 probably benign Het
Myo7b A G 18: 31,983,752 probably benign Het
Nadk2 C A 15: 9,106,782 L384I possibly damaging Het
Napg A G 18: 62,986,212 I98V possibly damaging Het
Ncoa1 G T 12: 4,274,790 N1041K probably benign Het
Nmu A T 5: 76,350,145 C64* probably null Het
Nobox T A 6: 43,307,198 K13M probably damaging Het
Nos1 T C 5: 117,953,783 probably benign Het
Nrg2 A G 18: 36,196,739 V141A probably damaging Het
Olfr170 T C 16: 19,606,027 I214V probably damaging Het
Olfr362 T G 2: 37,104,868 I261L probably benign Het
Olfr544 T A 7: 102,484,704 I139L probably benign Het
Phldb2 C T 16: 45,825,994 E71K possibly damaging Het
Pik3r4 T A 9: 105,644,291 Y19N probably damaging Het
Pkhd1 A C 1: 20,555,223 probably benign Het
Pogk G T 1: 166,400,138 P148Q possibly damaging Het
Ptpdc1 A T 13: 48,586,320 V545E possibly damaging Het
Qdpr G C 5: 45,450,138 probably benign Het
Rhbdd3 T A 11: 5,104,121 H83Q probably damaging Het
Rnf6 A G 5: 146,211,245 V321A probably benign Het
Rtf1 T A 2: 119,705,645 probably null Het
Serpina10 C T 12: 103,628,241 V240I probably benign Het
Siah2 A G 3: 58,691,514 V101A possibly damaging Het
Taok3 A G 5: 117,206,655 K46R probably damaging Het
Tcaf2 A C 6: 42,624,578 L849R probably damaging Het
Upf3a T C 8: 13,792,118 F178S probably damaging Het
Vmn1r218 G A 13: 23,137,308 G195D probably damaging Het
Vmn2r59 A G 7: 42,046,097 V297A probably damaging Het
Vmn2r70 T A 7: 85,558,761 Q836L probably benign Het
Zfp473 A G 7: 44,732,941 V655A probably benign Het
Zic5 A G 14: 122,459,485 S573P unknown Het
Other mutations in Pten
AlleleSourceChrCoordTypePredicted EffectPPH Score
Brakes UTSW 19 32815497 missense probably benign
Bremse UTSW 19 32800085 missense possibly damaging 0.91
R0131:Pten UTSW 19 32776069 missense probably benign 0.15
R0557:Pten UTSW 19 32817890 missense probably benign
R1479:Pten UTSW 19 32819850 missense probably damaging 0.99
R1773:Pten UTSW 19 32798072 missense probably damaging 1.00
R4801:Pten UTSW 19 32758503 missense possibly damaging 0.75
R4802:Pten UTSW 19 32758503 missense possibly damaging 0.75
R5196:Pten UTSW 19 32815497 missense probably benign
R5200:Pten UTSW 19 32799891 missense probably damaging 0.97
R5672:Pten UTSW 19 32758466 missense probably benign
R6143:Pten UTSW 19 32800085 missense possibly damaging 0.91
R7644:Pten UTSW 19 32811834 missense probably damaging 1.00
Z1088:Pten UTSW 19 32776051 missense probably damaging 0.96
Z1088:Pten UTSW 19 32799998 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGGTCAGTGCAGTTGAATTTACAGTG -3'
(R):5'- GTCGGTCCCCAGAAACTGTTCTTAC -3'

Sequencing Primer
(F):5'- tcttgaagttaacggaaatagtgac -3'
(R):5'- cagacagacagacagacagac -3'
Posted On2014-03-17