Incidental Mutation 'R1388:Il1a'
ID162480
Institutional Source Beutler Lab
Gene Symbol Il1a
Ensembl Gene ENSMUSG00000027399
Gene Nameinterleukin 1 alpha
SynonymsIl-1a
MMRRC Submission 039450-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1388 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location129299610-129309972 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 129306581 bp
ZygosityHeterozygous
Amino Acid Change Serine to Glycine at position 70 (S70G)
Ref Sequence ENSEMBL: ENSMUSP00000028882 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028882]
Predicted Effect possibly damaging
Transcript: ENSMUST00000028882
AA Change: S70G

PolyPhen 2 Score 0.922 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000028882
Gene: ENSMUSG00000027399
AA Change: S70G

DomainStartEndE-ValueType
Pfam:IL1_propep 1 111 2.2e-38 PFAM
IL1 131 270 8.14e-70 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144178
Meta Mutation Damage Score 0.4667 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 94.9%
  • 20x: 88.1%
Validation Efficiency 98% (47/48)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the interleukin 1 cytokine family. This cytokine is a pleiotropic cytokine involved in various immune responses, inflammatory processes, and hematopoiesis. This cytokine is produced by monocytes and macrophages as a proprotein, which is proteolytically processed and released in response to cell injury, and thus induces apoptosis. This gene and eight other interleukin 1 family genes form a cytokine gene cluster on chromosome 2. It has been suggested that the polymorphism of these genes is associated with rheumatoid arthritis and Alzheimer's disease. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit abnormal tumor vascularization, decreased metastatic potential, and decreased interleukin-1 beta secretion. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310050C09Rik G T 3: 92,869,049 T109K probably damaging Het
Acot3 T G 12: 84,058,987 H409Q possibly damaging Het
Adgra1 T C 7: 139,874,003 V152A probably damaging Het
Arhgef6 T C X: 57,338,562 M5V probably benign Het
Atxn7l3 C G 11: 102,292,435 probably benign Het
Ccdc174 C A 6: 91,881,244 probably null Het
Ccdc38 A T 10: 93,581,840 probably benign Het
Clca4b A T 3: 144,916,654 V550D probably benign Het
Dab2ip C T 2: 35,721,256 probably benign Het
Gm17661 GA GAA 2: 90,917,709 noncoding transcript Het
Gm2959 A T 14: 42,413,703 noncoding transcript Het
Gmnc A G 16: 26,963,912 L80P probably damaging Het
Gtf2ird1 T C 5: 134,395,710 D394G probably damaging Het
Heatr1 T C 13: 12,417,447 probably benign Het
Kctd19 T C 8: 105,392,051 S293G probably null Het
Klra4 T C 6: 130,062,235 probably benign Het
Mr1 T C 1: 155,132,503 E242G probably damaging Het
Mrnip C A 11: 50,196,945 A98E probably benign Het
Mybpc3 C T 2: 91,122,874 P155S probably benign Het
Myh14 A T 7: 44,665,122 Y126N probably damaging Het
Nrbp1 T A 5: 31,245,813 I210N probably damaging Het
Nupl1 A T 14: 60,244,670 probably benign Het
Olfr218 T C 1: 173,203,878 V174A probably benign Het
Olfr979 A G 9: 40,000,652 S192P probably damaging Het
Pnisr T C 4: 21,862,041 M243T possibly damaging Het
Ptprr A G 10: 116,273,752 S633G probably benign Het
Rasip1 T A 7: 45,630,232 S300T probably damaging Het
Sbsn A T 7: 30,752,151 H197L probably benign Het
Shf G A 2: 122,368,682 P51S probably damaging Het
Sim1 T A 10: 50,895,994 I33N probably damaging Het
Speg A G 1: 75,430,460 D2878G probably damaging Het
Taf2 T A 15: 55,036,625 N864I probably benign Het
Tmem43 G T 6: 91,478,803 probably null Het
Ttn T C 2: 76,711,791 E25290G probably damaging Het
Ush2a A G 1: 188,523,318 probably benign Het
Usp53 T C 3: 122,957,628 E260G probably damaging Het
Vmn2r12 T G 5: 109,092,974 Y91S possibly damaging Het
Vmn2r59 A T 7: 42,045,709 N426K probably benign Het
Whamm C A 7: 81,586,290 L414I probably damaging Het
Zfhx4 A G 3: 5,401,387 T2227A probably damaging Het
Zfp866 C T 8: 69,766,184 R262Q probably benign Het
Other mutations in Il1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01663:Il1a APN 2 129304717 missense probably benign
IGL01726:Il1a APN 2 129304720 missense possibly damaging 0.47
IGL02451:Il1a APN 2 129306655 missense probably damaging 0.98
IGL02537:Il1a APN 2 129309076 missense probably damaging 0.98
R0009:Il1a UTSW 2 129309074 missense probably damaging 0.99
R0009:Il1a UTSW 2 129309074 missense probably damaging 0.99
R0759:Il1a UTSW 2 129304687 missense probably damaging 1.00
R1521:Il1a UTSW 2 129304741 missense possibly damaging 0.83
R1699:Il1a UTSW 2 129302893 missense probably damaging 0.98
R3833:Il1a UTSW 2 129306679 missense possibly damaging 0.81
R4591:Il1a UTSW 2 129306527 missense probably damaging 1.00
R4643:Il1a UTSW 2 129304703 missense probably benign
R5433:Il1a UTSW 2 129307901 missense possibly damaging 0.79
R5572:Il1a UTSW 2 129307918 missense possibly damaging 0.83
R7345:Il1a UTSW 2 129304773 missense probably benign
R7876:Il1a UTSW 2 129300842 missense probably damaging 1.00
R8116:Il1a UTSW 2 129302944 missense probably damaging 1.00
R8162:Il1a UTSW 2 129306557 missense possibly damaging 0.92
R8248:Il1a UTSW 2 129302961 missense probably benign
RF003:Il1a UTSW 2 129302932 missense possibly damaging 0.56
Predicted Primers PCR Primer
(F):5'- ACCTTTACATGACCTTTGCAGTATGGC -3'
(R):5'- GCACAATGGGGACCACTCTCACTAAG -3'

Sequencing Primer
(F):5'- GTTTAGAAACAGGCTCCTACTGAC -3'
(R):5'- GGATACAGATCCTACTGAAGAATCTC -3'
Posted On2014-03-17