Incidental Mutation 'R1388:Usp53'
ID162483
Institutional Source Beutler Lab
Gene Symbol Usp53
Ensembl Gene ENSMUSG00000039701
Gene Nameubiquitin specific peptidase 53
SynonymsPhxr3, Sp6
MMRRC Submission 039450-MU
Accession Numbers

Ncbi RefSeq: NM_133857.3; MGI: 2139607

Is this an essential gene? Probably non essential (E-score: 0.161) question?
Stock #R1388 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location122931493-122984510 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 122957628 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 260 (E260G)
Ref Sequence ENSEMBL: ENSMUSP00000142600 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090379] [ENSMUST00000197314] [ENSMUST00000197934] [ENSMUST00000199329] [ENSMUST00000199401]
Predicted Effect probably damaging
Transcript: ENSMUST00000090379
AA Change: E260G

PolyPhen 2 Score 0.959 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000087857
Gene: ENSMUSG00000039701
AA Change: E260G

DomainStartEndE-ValueType
Pfam:UCH 29 348 1.6e-20 PFAM
Pfam:UCH_1 30 322 9.6e-9 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000197314
AA Change: E260G

PolyPhen 2 Score 0.959 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000142600
Gene: ENSMUSG00000039701
AA Change: E260G

DomainStartEndE-ValueType
Pfam:UCH 29 266 1.7e-15 PFAM
Pfam:UCH_1 30 266 2.3e-9 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197358
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197801
Predicted Effect probably benign
Transcript: ENSMUST00000197934
AA Change: E287G

PolyPhen 2 Score 0.074 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000143412
Gene: ENSMUSG00000039701
AA Change: E287G

DomainStartEndE-ValueType
Pfam:UCH 29 375 2.2e-21 PFAM
Pfam:UCH_1 30 349 5.1e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000199329
SMART Domains Protein: ENSMUSP00000143119
Gene: ENSMUSG00000039701

DomainStartEndE-ValueType
Pfam:UCH 29 126 1.8e-6 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000199401
SMART Domains Protein: ENSMUSP00000143460
Gene: ENSMUSG00000039701

DomainStartEndE-ValueType
low complexity region 76 87 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199923
Meta Mutation Damage Score 0.4548 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 94.9%
  • 20x: 88.1%
Validation Efficiency 98% (47/48)
MGI Phenotype PHENOTYPE: Homozygotes for an ENU-induced allele show progressive hearing loss associated with altered cochlear outer hair cell (OHC) morphology, reduced endocochlear potential, and early OHC loss followed by IHC and spiral ganglion degeneration. Heterozygotes are susceptible to noise-induced hearing loss. [provided by MGI curators]
Allele List at MGI

All alleles(48) : Gene trapped(48)

Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310050C09Rik G T 3: 92,869,049 T109K probably damaging Het
Acot3 T G 12: 84,058,987 H409Q possibly damaging Het
Adgra1 T C 7: 139,874,003 V152A probably damaging Het
Arhgef6 T C X: 57,338,562 M5V probably benign Het
Atxn7l3 C G 11: 102,292,435 probably benign Het
Ccdc174 C A 6: 91,881,244 probably null Het
Ccdc38 A T 10: 93,581,840 probably benign Het
Clca4b A T 3: 144,916,654 V550D probably benign Het
Dab2ip C T 2: 35,721,256 probably benign Het
Gm17661 GA GAA 2: 90,917,709 noncoding transcript Het
Gm2959 A T 14: 42,413,703 noncoding transcript Het
Gmnc A G 16: 26,963,912 L80P probably damaging Het
Gtf2ird1 T C 5: 134,395,710 D394G probably damaging Het
Heatr1 T C 13: 12,417,447 probably benign Het
Il1a T C 2: 129,306,581 S70G possibly damaging Het
Kctd19 T C 8: 105,392,051 S293G probably null Het
Klra4 T C 6: 130,062,235 probably benign Het
Mr1 T C 1: 155,132,503 E242G probably damaging Het
Mrnip C A 11: 50,196,945 A98E probably benign Het
Mybpc3 C T 2: 91,122,874 P155S probably benign Het
Myh14 A T 7: 44,665,122 Y126N probably damaging Het
Nrbp1 T A 5: 31,245,813 I210N probably damaging Het
Nupl1 A T 14: 60,244,670 probably benign Het
Olfr218 T C 1: 173,203,878 V174A probably benign Het
Olfr979 A G 9: 40,000,652 S192P probably damaging Het
Pnisr T C 4: 21,862,041 M243T possibly damaging Het
Ptprr A G 10: 116,273,752 S633G probably benign Het
Rasip1 T A 7: 45,630,232 S300T probably damaging Het
Sbsn A T 7: 30,752,151 H197L probably benign Het
Shf G A 2: 122,368,682 P51S probably damaging Het
Sim1 T A 10: 50,895,994 I33N probably damaging Het
Speg A G 1: 75,430,460 D2878G probably damaging Het
Taf2 T A 15: 55,036,625 N864I probably benign Het
Tmem43 G T 6: 91,478,803 probably null Het
Ttn T C 2: 76,711,791 E25290G probably damaging Het
Ush2a A G 1: 188,523,318 probably benign Het
Vmn2r12 T G 5: 109,092,974 Y91S possibly damaging Het
Vmn2r59 A T 7: 42,045,709 N426K probably benign Het
Whamm C A 7: 81,586,290 L414I probably damaging Het
Zfhx4 A G 3: 5,401,387 T2227A probably damaging Het
Zfp866 C T 8: 69,766,184 R262Q probably benign Het
Other mutations in Usp53
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01112:Usp53 APN 3 122957718 missense probably damaging 0.99
IGL01965:Usp53 APN 3 122961153 critical splice donor site probably null
IGL02115:Usp53 APN 3 122947390 missense probably benign 0.25
IGL02993:Usp53 APN 3 122933843 missense probably damaging 1.00
IGL03119:Usp53 APN 3 122961415 missense possibly damaging 0.80
IGL03206:Usp53 APN 3 122953183 missense probably benign
IGL03369:Usp53 APN 3 122933721 utr 3 prime probably benign
R0066:Usp53 UTSW 3 122953307 nonsense probably null
R0066:Usp53 UTSW 3 122953307 nonsense probably null
R0366:Usp53 UTSW 3 122949201 missense probably damaging 1.00
R1015:Usp53 UTSW 3 122933759 missense probably benign 0.02
R1592:Usp53 UTSW 3 122934050 nonsense probably null
R1635:Usp53 UTSW 3 122934223 missense probably benign 0.03
R1707:Usp53 UTSW 3 122947400 missense probably benign
R2177:Usp53 UTSW 3 122936057 missense probably damaging 0.99
R2848:Usp53 UTSW 3 122934491 missense probably benign 0.00
R2898:Usp53 UTSW 3 122957574 nonsense probably null
R3411:Usp53 UTSW 3 122949858 critical splice acceptor site probably null
R3618:Usp53 UTSW 3 122934412 missense probably benign 0.25
R3713:Usp53 UTSW 3 122949319 missense probably benign 0.08
R3715:Usp53 UTSW 3 122949319 missense probably benign 0.08
R3923:Usp53 UTSW 3 122934305 missense probably benign 0.11
R4616:Usp53 UTSW 3 122959120 missense probably damaging 1.00
R4718:Usp53 UTSW 3 122933982 missense probably benign 0.22
R4730:Usp53 UTSW 3 122962933 missense probably null 0.82
R4860:Usp53 UTSW 3 122961363 missense possibly damaging 0.90
R4860:Usp53 UTSW 3 122961363 missense possibly damaging 0.90
R5073:Usp53 UTSW 3 122933946 missense probably benign 0.21
R5580:Usp53 UTSW 3 122934234 missense probably benign 0.00
R5894:Usp53 UTSW 3 122959085 missense probably damaging 0.96
R6176:Usp53 UTSW 3 122934003 nonsense probably null
R6191:Usp53 UTSW 3 122949741 missense probably damaging 0.96
R6634:Usp53 UTSW 3 122964286 missense probably benign 0.00
R7179:Usp53 UTSW 3 122949710 missense probably benign 0.01
R7211:Usp53 UTSW 3 122957650 missense probably damaging 0.98
R7613:Usp53 UTSW 3 122949818 missense probably benign 0.43
R7621:Usp53 UTSW 3 122961285 missense probably benign 0.00
R7652:Usp53 UTSW 3 122953235 missense possibly damaging 0.80
R7753:Usp53 UTSW 3 122949238 missense probably damaging 1.00
R7859:Usp53 UTSW 3 122949766 missense possibly damaging 0.91
R7861:Usp53 UTSW 3 122934463 missense probably benign 0.26
R7911:Usp53 UTSW 3 122961267 missense probably benign 0.00
R7942:Usp53 UTSW 3 122949766 missense possibly damaging 0.91
R7944:Usp53 UTSW 3 122934463 missense probably benign 0.26
R7992:Usp53 UTSW 3 122961267 missense probably benign 0.00
X0025:Usp53 UTSW 3 122957583 critical splice donor site probably null
Z1177:Usp53 UTSW 3 122953195 missense not run
Predicted Primers PCR Primer
(F):5'- CCAATCATCACTCCAGGGTGAAAGG -3'
(R):5'- CTGCACAGGAGTCGTGTTGTCG -3'

Sequencing Primer
(F):5'- GGAAAAAGGTATTCCACTTAGTCTG -3'
(R):5'- TTGGACAGAGTCTAATACCAAGCTG -3'
Posted On2014-03-17