Incidental Mutation 'R1388:Gtf2ird1'
ID 162488
Institutional Source Beutler Lab
Gene Symbol Gtf2ird1
Ensembl Gene ENSMUSG00000023079
Gene Name general transcription factor II I repeat domain-containing 1
Synonyms ESTM9, BEN, binding factor for early enhancer, MusTRD1, GTF3, Cream1, WBSCR11
MMRRC Submission 039450-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.696) question?
Stock # R1388 (G1)
Quality Score 216
Status Validated
Chromosome 5
Chromosomal Location 134386510-134485570 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 134424564 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 394 (D394G)
Ref Sequence ENSEMBL: ENSMUSP00000143809 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073161] [ENSMUST00000074114] [ENSMUST00000100650] [ENSMUST00000100652] [ENSMUST00000100654] [ENSMUST00000111244] [ENSMUST00000111245] [ENSMUST00000167084] [ENSMUST00000200944] [ENSMUST00000171794] [ENSMUST00000202554] [ENSMUST00000202280]
AlphaFold Q9JI57
Predicted Effect probably damaging
Transcript: ENSMUST00000073161
AA Change: D394G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000072904
Gene: ENSMUSG00000023079
AA Change: D394G

DomainStartEndE-ValueType
Pfam:GTF2I 128 203 1.5e-29 PFAM
Pfam:GTF2I 351 426 4.9e-33 PFAM
low complexity region 543 558 N/A INTRINSIC
Pfam:GTF2I 565 640 1.1e-34 PFAM
Pfam:GTF2I 690 765 3.1e-34 PFAM
Pfam:GTF2I 814 889 1.7e-34 PFAM
Pfam:GTF2I 917 992 1.7e-34 PFAM
low complexity region 1020 1043 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000074114
AA Change: D394G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000073752
Gene: ENSMUSG00000023079
AA Change: D394G

DomainStartEndE-ValueType
Pfam:GTF2I 128 203 1.4e-29 PFAM
Pfam:GTF2I 351 426 4.5e-33 PFAM
low complexity region 543 558 N/A INTRINSIC
Pfam:GTF2I 565 640 1.1e-34 PFAM
Pfam:GTF2I 690 765 2.8e-34 PFAM
Pfam:GTF2I 814 889 1.6e-34 PFAM
low complexity region 917 940 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000100650
AA Change: D394G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000098215
Gene: ENSMUSG00000023079
AA Change: D394G

DomainStartEndE-ValueType
Pfam:GTF2I 128 203 1.5e-29 PFAM
Pfam:GTF2I 351 426 4.9e-33 PFAM
low complexity region 543 558 N/A INTRINSIC
Pfam:GTF2I 565 640 1.2e-34 PFAM
Pfam:GTF2I 690 765 3.1e-34 PFAM
Pfam:GTF2I 787 862 1.8e-34 PFAM
Pfam:GTF2I 890 965 1.8e-34 PFAM
low complexity region 993 1016 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000100652
AA Change: D394G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000098217
Gene: ENSMUSG00000023079
AA Change: D394G

DomainStartEndE-ValueType
Pfam:GTF2I 128 202 5.8e-29 PFAM
Pfam:GTF2I 351 425 6.6e-32 PFAM
low complexity region 543 558 N/A INTRINSIC
Pfam:GTF2I 565 639 2.3e-34 PFAM
Pfam:GTF2I 690 764 3.3e-32 PFAM
Pfam:GTF2I 814 888 3e-33 PFAM
Pfam:GTF2I 917 991 3e-33 PFAM
low complexity region 1020 1043 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000100654
AA Change: D394G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000098219
Gene: ENSMUSG00000023079
AA Change: D394G

DomainStartEndE-ValueType
Pfam:GTF2I 128 203 1.3e-29 PFAM
Pfam:GTF2I 351 426 4.3e-33 PFAM
low complexity region 543 558 N/A INTRINSIC
Pfam:GTF2I 565 640 1e-34 PFAM
Pfam:GTF2I 716 791 1.5e-34 PFAM
Pfam:GTF2I 819 894 1.5e-34 PFAM
low complexity region 922 945 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000111244
AA Change: D394G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000106875
Gene: ENSMUSG00000023079
AA Change: D394G

DomainStartEndE-ValueType
Pfam:GTF2I 128 202 4.3e-29 PFAM
Pfam:GTF2I 351 425 4.9e-32 PFAM
low complexity region 543 558 N/A INTRINSIC
Pfam:GTF2I 565 639 1.7e-34 PFAM
Pfam:GTF2I 690 764 2.5e-32 PFAM
Pfam:GTF2I 787 861 2.3e-33 PFAM
Pfam:GTF2I 890 964 2.3e-33 PFAM
low complexity region 993 1016 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000111245
AA Change: D394G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000106876
Gene: ENSMUSG00000023079
AA Change: D394G

DomainStartEndE-ValueType
Pfam:GTF2I 128 203 1.4e-29 PFAM
Pfam:GTF2I 351 426 4.6e-33 PFAM
low complexity region 543 558 N/A INTRINSIC
Pfam:GTF2I 565 640 1.1e-34 PFAM
Pfam:GTF2I 671 746 2.9e-34 PFAM
Pfam:GTF2I 768 843 1.7e-34 PFAM
Pfam:GTF2I 871 946 1.7e-34 PFAM
low complexity region 974 997 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000167084
AA Change: D394G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000132882
Gene: ENSMUSG00000023079
AA Change: D394G

DomainStartEndE-ValueType
Pfam:GTF2I 128 203 1.3e-29 PFAM
Pfam:GTF2I 351 426 4.3e-33 PFAM
low complexity region 543 558 N/A INTRINSIC
Pfam:GTF2I 565 640 1e-34 PFAM
Pfam:GTF2I 690 765 2.7e-34 PFAM
Pfam:GTF2I 814 889 1.5e-34 PFAM
low complexity region 917 940 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000200944
AA Change: D394G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000143848
Gene: ENSMUSG00000023079
AA Change: D394G

DomainStartEndE-ValueType
Pfam:GTF2I 128 202 4.9e-29 PFAM
Pfam:GTF2I 351 425 5.6e-32 PFAM
low complexity region 543 558 N/A INTRINSIC
Pfam:GTF2I 565 639 2e-34 PFAM
Pfam:GTF2I 690 764 2.8e-32 PFAM
Pfam:GTF2I 814 888 2.6e-33 PFAM
low complexity region 917 940 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000171794
AA Change: D394G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000129392
Gene: ENSMUSG00000023079
AA Change: D394G

DomainStartEndE-ValueType
Pfam:GTF2I 128 203 1.2e-29 PFAM
Pfam:GTF2I 351 426 3.8e-33 PFAM
low complexity region 543 558 N/A INTRINSIC
Pfam:GTF2I 565 640 8.9e-35 PFAM
Pfam:GTF2I 690 765 2.4e-34 PFAM
Pfam:GTF2I 787 862 1.4e-34 PFAM
Pfam:GTF2I 890 965 1.4e-34 PFAM
low complexity region 993 1016 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000202554
AA Change: D394G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000143809
Gene: ENSMUSG00000023079
AA Change: D394G

DomainStartEndE-ValueType
Pfam:GTF2I 128 202 5.5e-29 PFAM
Pfam:GTF2I 351 425 6.3e-32 PFAM
low complexity region 543 558 N/A INTRINSIC
Pfam:GTF2I 565 639 2.2e-34 PFAM
Pfam:GTF2I 671 745 3.2e-32 PFAM
Pfam:GTF2I 768 842 2.9e-33 PFAM
Pfam:GTF2I 871 945 2.9e-33 PFAM
low complexity region 974 997 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000202280
AA Change: D394G

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000143897
Gene: ENSMUSG00000023079
AA Change: D394G

DomainStartEndE-ValueType
Pfam:GTF2I 128 202 2.6e-26 PFAM
Pfam:GTF2I 351 425 2.9e-29 PFAM
low complexity region 543 558 N/A INTRINSIC
Pfam:GTF2I 565 639 1e-31 PFAM
Pfam:GTF2I 690 764 1.5e-29 PFAM
Pfam:GTF2I 787 861 1.3e-30 PFAM
low complexity region 890 913 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000201441
AA Change: D29G
Predicted Effect unknown
Transcript: ENSMUST00000201447
AA Change: D29G
Predicted Effect unknown
Transcript: ENSMUST00000200798
AA Change: D29G
Predicted Effect unknown
Transcript: ENSMUST00000201704
AA Change: D181G
Predicted Effect unknown
Transcript: ENSMUST00000201526
AA Change: D29G
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202202
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202335
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202334
Meta Mutation Damage Score 0.7086 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 94.9%
  • 20x: 88.1%
Validation Efficiency 98% (47/48)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains five GTF2I-like repeats and each repeat possesses a potential helix-loop-helix (HLH) motif. It may have the ability to interact with other HLH-proteins and function as a transcription factor or as a positive transcriptional regulator under the control of Retinoblastoma protein. This gene plays a role in craniofacial and cognitive development and mutations have been associated with Williams-Beuren syndrome, a multisystem developmental disorder caused by deletion of multiple genes at 7q11.23. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2010]
PHENOTYPE: Homozygotes for one null allele is embryonic lethal with abnormal yolk sac vasulogenesis, abnormal angiogenesis, and neural tube defect. Other null allele homozygous mice are viable and have behavioral defects and exhibit a mild craniofacial defect withvariable penetrance. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acot3 T G 12: 84,105,761 (GRCm39) H409Q possibly damaging Het
Adgra1 T C 7: 139,453,919 (GRCm39) V152A probably damaging Het
Arhgef6 T C X: 56,383,922 (GRCm39) M5V probably benign Het
Atxn7l3 C G 11: 102,183,261 (GRCm39) probably benign Het
Ccdc174 C A 6: 91,858,225 (GRCm39) probably null Het
Ccdc38 A T 10: 93,417,702 (GRCm39) probably benign Het
Clca4b A T 3: 144,622,415 (GRCm39) V550D probably benign Het
Dab2ip C T 2: 35,611,268 (GRCm39) probably benign Het
Gm17661 GA GAA 2: 90,917,709 (GRCm38) noncoding transcript Het
Gm2959 A T 14: 42,235,660 (GRCm39) noncoding transcript Het
Gmnc A G 16: 26,782,662 (GRCm39) L80P probably damaging Het
Heatr1 T C 13: 12,432,328 (GRCm39) probably benign Het
Il1a T C 2: 129,148,501 (GRCm39) S70G possibly damaging Het
Kctd19 T C 8: 106,118,683 (GRCm39) S293G probably null Het
Klra4 T C 6: 130,039,198 (GRCm39) probably benign Het
Kplce G T 3: 92,776,356 (GRCm39) T109K probably damaging Het
Mr1 T C 1: 155,008,249 (GRCm39) E242G probably damaging Het
Mrnip C A 11: 50,087,772 (GRCm39) A98E probably benign Het
Mybpc3 C T 2: 90,953,219 (GRCm39) P155S probably benign Het
Myh14 A T 7: 44,314,546 (GRCm39) Y126N probably damaging Het
Nrbp1 T A 5: 31,403,157 (GRCm39) I210N probably damaging Het
Nup58 A T 14: 60,482,119 (GRCm39) probably benign Het
Or10g9 A G 9: 39,911,948 (GRCm39) S192P probably damaging Het
Or10j3 T C 1: 173,031,445 (GRCm39) V174A probably benign Het
Pnisr T C 4: 21,862,041 (GRCm39) M243T possibly damaging Het
Ptprr A G 10: 116,109,657 (GRCm39) S633G probably benign Het
Rasip1 T A 7: 45,279,656 (GRCm39) S300T probably damaging Het
Sbsn A T 7: 30,451,576 (GRCm39) H197L probably benign Het
Shf G A 2: 122,199,163 (GRCm39) P51S probably damaging Het
Sim1 T A 10: 50,772,090 (GRCm39) I33N probably damaging Het
Speg A G 1: 75,407,104 (GRCm39) D2878G probably damaging Het
Taf2 T A 15: 54,900,021 (GRCm39) N864I probably benign Het
Tmem43 G T 6: 91,455,785 (GRCm39) probably null Het
Ttn T C 2: 76,542,135 (GRCm39) E25290G probably damaging Het
Ush2a A G 1: 188,255,515 (GRCm39) probably benign Het
Usp53 T C 3: 122,751,277 (GRCm39) E260G probably damaging Het
Vmn2r12 T G 5: 109,240,840 (GRCm39) Y91S possibly damaging Het
Vmn2r59 A T 7: 41,695,133 (GRCm39) N426K probably benign Het
Whamm C A 7: 81,236,038 (GRCm39) L414I probably damaging Het
Zfhx4 A G 3: 5,466,447 (GRCm39) T2227A probably damaging Het
Zfp866 C T 8: 70,218,834 (GRCm39) R262Q probably benign Het
Other mutations in Gtf2ird1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00558:Gtf2ird1 APN 5 134,387,745 (GRCm39) missense probably benign 0.03
IGL02477:Gtf2ird1 APN 5 134,408,832 (GRCm39) missense probably damaging 1.00
IGL02659:Gtf2ird1 APN 5 134,405,895 (GRCm39) missense probably damaging 1.00
IGL02752:Gtf2ird1 APN 5 134,387,678 (GRCm39) makesense probably null
IGL02963:Gtf2ird1 APN 5 134,418,541 (GRCm39) missense probably benign 0.05
IGL03328:Gtf2ird1 APN 5 134,417,983 (GRCm39) critical splice donor site probably null
IGL03379:Gtf2ird1 APN 5 134,411,392 (GRCm39) missense possibly damaging 0.94
R0585:Gtf2ird1 UTSW 5 134,405,796 (GRCm39) missense probably damaging 1.00
R1199:Gtf2ird1 UTSW 5 134,439,918 (GRCm39) missense possibly damaging 0.85
R1470:Gtf2ird1 UTSW 5 134,424,656 (GRCm39) critical splice acceptor site probably null
R1470:Gtf2ird1 UTSW 5 134,424,656 (GRCm39) critical splice acceptor site probably null
R1544:Gtf2ird1 UTSW 5 134,387,772 (GRCm39) missense possibly damaging 0.93
R1652:Gtf2ird1 UTSW 5 134,424,567 (GRCm39) missense probably damaging 1.00
R1792:Gtf2ird1 UTSW 5 134,395,790 (GRCm39) splice site probably null
R1852:Gtf2ird1 UTSW 5 134,411,434 (GRCm39) splice site probably null
R1938:Gtf2ird1 UTSW 5 134,444,099 (GRCm39) missense probably damaging 1.00
R1996:Gtf2ird1 UTSW 5 134,405,740 (GRCm39) splice site probably benign
R2020:Gtf2ird1 UTSW 5 134,445,947 (GRCm39) missense probably damaging 1.00
R2025:Gtf2ird1 UTSW 5 134,392,788 (GRCm39) missense probably damaging 1.00
R2849:Gtf2ird1 UTSW 5 134,387,861 (GRCm39) missense probably damaging 1.00
R2964:Gtf2ird1 UTSW 5 134,386,538 (GRCm39) splice site probably null
R3421:Gtf2ird1 UTSW 5 134,417,354 (GRCm39) missense probably benign 0.41
R4543:Gtf2ird1 UTSW 5 134,392,754 (GRCm39) critical splice donor site probably null
R4569:Gtf2ird1 UTSW 5 134,439,857 (GRCm39) missense probably damaging 1.00
R4664:Gtf2ird1 UTSW 5 134,412,756 (GRCm39) missense probably damaging 1.00
R4665:Gtf2ird1 UTSW 5 134,412,756 (GRCm39) missense probably damaging 1.00
R4666:Gtf2ird1 UTSW 5 134,412,756 (GRCm39) missense probably damaging 1.00
R4680:Gtf2ird1 UTSW 5 134,386,735 (GRCm39) missense probably damaging 1.00
R4709:Gtf2ird1 UTSW 5 134,433,588 (GRCm39) missense probably benign
R4806:Gtf2ird1 UTSW 5 134,412,750 (GRCm39) missense probably damaging 0.99
R4823:Gtf2ird1 UTSW 5 134,424,576 (GRCm39) missense probably damaging 1.00
R4857:Gtf2ird1 UTSW 5 134,391,398 (GRCm39) missense probably damaging 0.96
R4970:Gtf2ird1 UTSW 5 134,431,038 (GRCm39) missense probably damaging 1.00
R4974:Gtf2ird1 UTSW 5 134,386,685 (GRCm39) nonsense probably null
R4975:Gtf2ird1 UTSW 5 134,424,481 (GRCm39) missense probably damaging 1.00
R5072:Gtf2ird1 UTSW 5 134,419,787 (GRCm39) splice site probably null
R5112:Gtf2ird1 UTSW 5 134,431,038 (GRCm39) missense probably damaging 1.00
R5653:Gtf2ird1 UTSW 5 134,439,821 (GRCm39) missense probably damaging 1.00
R5681:Gtf2ird1 UTSW 5 134,392,172 (GRCm39) missense probably damaging 1.00
R5738:Gtf2ird1 UTSW 5 134,412,672 (GRCm39) missense probably damaging 1.00
R5753:Gtf2ird1 UTSW 5 134,439,837 (GRCm39) missense probably damaging 1.00
R6385:Gtf2ird1 UTSW 5 134,433,544 (GRCm39) missense probably benign 0.19
R6580:Gtf2ird1 UTSW 5 134,389,893 (GRCm39) missense probably damaging 1.00
R6787:Gtf2ird1 UTSW 5 134,392,766 (GRCm39) missense probably damaging 0.99
R6981:Gtf2ird1 UTSW 5 134,412,776 (GRCm39) splice site probably benign
R7208:Gtf2ird1 UTSW 5 134,439,948 (GRCm39) missense probably benign 0.35
R7271:Gtf2ird1 UTSW 5 134,433,758 (GRCm39) missense probably benign 0.01
R7517:Gtf2ird1 UTSW 5 134,391,379 (GRCm39) missense probably benign
R7786:Gtf2ird1 UTSW 5 134,419,753 (GRCm39) nonsense probably null
R7788:Gtf2ird1 UTSW 5 134,445,985 (GRCm39) nonsense probably null
R7850:Gtf2ird1 UTSW 5 134,392,069 (GRCm39) missense probably benign 0.21
R7866:Gtf2ird1 UTSW 5 134,392,063 (GRCm39) missense probably benign 0.01
R8183:Gtf2ird1 UTSW 5 134,386,689 (GRCm39) missense unknown
R8712:Gtf2ird1 UTSW 5 134,444,064 (GRCm39) missense probably damaging 1.00
R8844:Gtf2ird1 UTSW 5 134,389,879 (GRCm39) nonsense probably null
R9473:Gtf2ird1 UTSW 5 134,433,534 (GRCm39) missense probably benign 0.08
R9669:Gtf2ird1 UTSW 5 134,408,794 (GRCm39) missense probably damaging 0.99
R9737:Gtf2ird1 UTSW 5 134,408,794 (GRCm39) missense probably damaging 0.99
X0026:Gtf2ird1 UTSW 5 134,404,956 (GRCm39) splice site probably null
Z1176:Gtf2ird1 UTSW 5 134,438,166 (GRCm39) critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- CCCAAAGCTCTAGAATCATCTGCTCC -3'
(R):5'- GCCAACACCGTATCCACTGTGACT -3'

Sequencing Primer
(F):5'- tgggggattataggcaaggg -3'
(R):5'- CGTATCCACTGTGACTTGTCC -3'
Posted On 2014-03-17