Incidental Mutation 'R1389:Zc3h11a'
Institutional Source Beutler Lab
Gene Symbol Zc3h11a
Ensembl Gene ENSMUSG00000116275
Gene Name
Synonyms1110003F06Rik, 5730454B08Rik, G630041M05Rik
MMRRC Submission 039451-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1389 (G1)
Quality Score225
Status Not validated
Chromosomal Location133619871-133661380 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 133633803 bp
Amino Acid Change Valine to Glutamic Acid at position 310 (V310E)
Ref Sequence ENSEMBL: ENSMUSP00000141255 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027736] [ENSMUST00000179598] [ENSMUST00000186476] [ENSMUST00000191896]
Predicted Effect probably damaging
Transcript: ENSMUST00000027736
AA Change: V310E

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000027736
Gene: ENSMUSG00000116275
AA Change: V310E

ZnF_C3H1 3 28 4.26e-1 SMART
ZnF_C3H1 31 56 7.62e0 SMART
ZnF_C3H1 60 86 6.83e1 SMART
low complexity region 161 176 N/A INTRINSIC
low complexity region 218 241 N/A INTRINSIC
low complexity region 367 376 N/A INTRINSIC
low complexity region 625 647 N/A INTRINSIC
low complexity region 717 730 N/A INTRINSIC
low complexity region 770 788 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000179598
SMART Domains Protein: ENSMUSP00000136026
Gene: ENSMUSG00000094410

low complexity region 57 84 N/A INTRINSIC
ZnF_BED 130 183 1.42e-8 SMART
low complexity region 203 215 N/A INTRINSIC
ZnF_BED 265 318 5.37e-9 SMART
low complexity region 840 862 N/A INTRINSIC
Pfam:Dimer_Tnp_hAT 869 950 9.3e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000186476
SMART Domains Protein: ENSMUSP00000139417
Gene: ENSMUSG00000094410

low complexity region 57 84 N/A INTRINSIC
ZnF_BED 130 183 1.42e-8 SMART
low complexity region 203 215 N/A INTRINSIC
ZnF_BED 265 318 5.37e-9 SMART
low complexity region 840 862 N/A INTRINSIC
Pfam:Dimer_Tnp_hAT 869 950 1.9e-12 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000191896
AA Change: V310E

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000141255
Gene: ENSMUSG00000102976
AA Change: V310E

ZnF_C3H1 3 28 4.26e-1 SMART
ZnF_C3H1 31 56 7.62e0 SMART
ZnF_C3H1 60 86 6.83e1 SMART
low complexity region 161 176 N/A INTRINSIC
low complexity region 218 241 N/A INTRINSIC
low complexity region 367 376 N/A INTRINSIC
low complexity region 625 647 N/A INTRINSIC
low complexity region 717 730 N/A INTRINSIC
low complexity region 770 788 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000195669
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.7%
  • 20x: 90.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsl3 A C 1: 78,688,282 I142L probably benign Het
Adgra2 C T 8: 27,111,088 P252L probably damaging Het
Akap6 A G 12: 53,139,520 E1239G probably benign Het
Arhgef17 TGGAGGAGGAGGAGGAGG TGGAGGAGGAGGAGG 7: 100,931,037 probably benign Het
Btbd11 A G 10: 85,640,596 T914A possibly damaging Het
Calml4 A T 9: 62,871,266 D12V probably damaging Het
Car9 G T 4: 43,512,439 probably null Het
Ccar2 C A 14: 70,140,109 V699L possibly damaging Het
Ccdc27 T C 4: 154,041,769 M88V unknown Het
Ceacam15 T C 7: 16,672,063 R188G probably damaging Het
Dcaf8 G A 1: 172,174,052 R272H probably benign Het
Dchs1 A G 7: 105,755,571 V2588A probably benign Het
Dst G A 1: 34,211,232 R1749H probably damaging Het
Exog A G 9: 119,462,506 Q283R probably benign Het
Fmnl1 A T 11: 103,186,709 probably null Het
Gramd1c T C 16: 43,990,722 D213G probably damaging Het
Iqgap1 A G 7: 80,759,756 probably null Het
Itgae A G 11: 73,125,362 Y799C probably damaging Het
Kalrn T C 16: 33,988,803 I903V probably benign Het
Kcnh1 A G 1: 192,505,763 E844G probably benign Het
Khdc1a A T 1: 21,350,027 D3V probably damaging Het
Ly6g T C 15: 75,156,766 F25S probably benign Het
Mapk1ip1 G A 7: 138,836,727 probably benign Het
Mfsd3 A G 15: 76,702,689 H243R probably benign Het
Mms22l T A 4: 24,591,076 Y1016N probably damaging Het
Mrgprb5 A T 7: 48,168,330 V219E probably damaging Het
Nars2 G A 7: 97,002,829 S209N probably benign Het
Nckap5 T C 1: 126,026,710 T702A probably damaging Het
Olfr385 T C 11: 73,589,543 N65S possibly damaging Het
Paf1 A G 7: 28,398,832 probably benign Het
Prl3d1 A T 13: 27,098,710 R145* probably null Het
Rasl10b G A 11: 83,417,839 probably null Het
Rnf13 T A 3: 57,779,496 N103K probably damaging Het
Senp1 T C 15: 98,075,853 S170G probably benign Het
Slc46a2 A G 4: 59,914,620 L101P probably damaging Het
Tmem123 C T 9: 7,791,106 T136M probably damaging Het
Tpo T A 12: 30,103,110 H415L probably damaging Het
Vipr2 A G 12: 116,137,330 I255V probably benign Het
Zfp3 T A 11: 70,772,636 C474S probably damaging Het
Zfp707 T A 15: 75,974,616 C99S probably damaging Het
Zranb1 C T 7: 132,971,333 P410S probably damaging Het
Zswim8 G T 14: 20,710,748 R30L probably damaging Het
Other mutations in Zc3h11a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01329:Zc3h11a APN 1 133625862 missense probably benign
IGL01961:Zc3h11a APN 1 133627067 missense probably benign 0.12
IGL02005:Zc3h11a APN 1 133622142 missense probably benign
IGL02365:Zc3h11a APN 1 133637413 missense probably benign 0.02
IGL02454:Zc3h11a APN 1 133624516 missense probably benign 0.09
PIT4449001:Zc3h11a UTSW 1 133624611 missense probably benign 0.22
R0180:Zc3h11a UTSW 1 133621611 missense probably benign 0.11
R0965:Zc3h11a UTSW 1 133645803 missense possibly damaging 0.80
R1607:Zc3h11a UTSW 1 133624687 missense probably benign
R1639:Zc3h11a UTSW 1 133624708 missense probably benign 0.03
R1720:Zc3h11a UTSW 1 133621701 missense probably damaging 0.97
R1728:Zc3h11a UTSW 1 133622154 missense probably benign
R1728:Zc3h11a UTSW 1 133624621 missense probably benign 0.20
R1729:Zc3h11a UTSW 1 133622154 missense probably benign
R1730:Zc3h11a UTSW 1 133622154 missense probably benign
R1730:Zc3h11a UTSW 1 133624621 missense probably benign 0.20
R1739:Zc3h11a UTSW 1 133622154 missense probably benign
R1739:Zc3h11a UTSW 1 133624621 missense probably benign 0.20
R1762:Zc3h11a UTSW 1 133622154 missense probably benign
R1762:Zc3h11a UTSW 1 133624621 missense probably benign 0.20
R1783:Zc3h11a UTSW 1 133622154 missense probably benign
R1783:Zc3h11a UTSW 1 133624621 missense probably benign 0.20
R1784:Zc3h11a UTSW 1 133622154 missense probably benign
R1784:Zc3h11a UTSW 1 133624621 missense probably benign 0.20
R1785:Zc3h11a UTSW 1 133622154 missense probably benign
R1785:Zc3h11a UTSW 1 133624621 missense probably benign 0.20
R2508:Zc3h11a UTSW 1 133624783 missense probably benign 0.01
R4792:Zc3h11a UTSW 1 133640698 missense probably damaging 0.98
R4901:Zc3h11a UTSW 1 133624711 missense probably benign 0.00
R4932:Zc3h11a UTSW 1 133624612 missense probably benign 0.00
R5135:Zc3h11a UTSW 1 133633789 missense probably benign 0.00
R5186:Zc3h11a UTSW 1 133621674 missense probably damaging 0.99
R5357:Zc3h11a UTSW 1 133623042 missense probably damaging 1.00
R5438:Zc3h11a UTSW 1 133640647 missense probably damaging 1.00
R6149:Zc3h11a UTSW 1 133638875 nonsense probably null
R6268:Zc3h11a UTSW 1 133624557 missense probably benign 0.01
R6385:Zc3h11a UTSW 1 133637454 missense possibly damaging 0.82
R6847:Zc3h11a UTSW 1 133638962 splice site probably null
R7107:Zc3h11a UTSW 1 133638917 missense probably damaging 0.96
R7543:Zc3h11a UTSW 1 133627030 missense possibly damaging 0.49
R7693:Zc3h11a UTSW 1 133645737 missense probably damaging 1.00
Predicted Primers PCR Primer

Sequencing Primer
(R):5'- gggtttttctgcatagacttgg -3'
Posted On2014-03-17