Mutagenetix > Incidental Mutations

Incidental Mutation 'R1389:Mms22l'

162524

Institutional Source

Beutler Lab

Gene Symbol

Mms22l

Ensembl Gene

ENSMUSG00000045751

Gene Name

MMS22-like, DNA repair protein

Synonyms

F730047E07Rik

MMRRC Submission

039451-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R1389 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

24496451-24602950 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 24591076 bp

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Asparagine at position 1016 (Y1016N)

Ref Sequence

ENSEMBL: ENSMUSP00000103857 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000050446] [ENSMUST00000108222]

Predicted Effect

probably damaging
Transcript: ENSMUST00000050446
AA Change: Y976N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000057715
Gene: ENSMUSG00000045751
AA Change: Y976N

Domain	Start	End	E-Value	Type
Pfam:MMS22L_N	26	395	1.1e-199	PFAM
Pfam:MMS22L_N	392	690	4.6e-155	PFAM
low complexity region	698	711	N/A	INTRINSIC
low complexity region	761	770	N/A	INTRINSIC
Pfam:MMS22L_C	809	1186	2.3e-133	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000108222
AA Change: Y1016N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000103857
Gene: ENSMUSG00000045751
AA Change: Y1016N

Domain	Start	End	E-Value	Type
Pfam:MMS22L_N	26	730	N/A	PFAM
low complexity region	738	751	N/A	INTRINSIC
low complexity region	801	810	N/A	INTRINSIC
Pfam:MMS22L_C	849	1225	1.4e-142	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000123984

Predicted Effect

probably benign
Transcript: ENSMUST00000131282

SMART Domains

Protein: ENSMUSP00000133800
Gene: ENSMUSG00000045751

Domain	Start	End	E-Value	Type
Pfam:MMS22L_N	1	459	1.3e-239	PFAM
low complexity region	467	480	N/A	INTRINSIC
low complexity region	530	539	N/A	INTRINSIC
Pfam:MMS22L_C	578	733	1.9e-58	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000154349

Coding Region Coverage

1x: 99.0%
3x: 98.1%
10x: 95.7%
20x: 90.6%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene forms a complex with tonsoku-like, DNA repair protein (TONSL), and this complex recognizes and repairs DNA double-strand breaks at sites of stalled or collapsed replication forks. The encoded protein also can bind with the histone-associated protein NFKBIL2 to help regulate the chromatin state at stalled replication forks. Finally, this gene appears to be overexpressed in most lung and esophageal cancers. Multiple transcript variants exist for this gene, but the full-length nature of only one has been determined to date. [provided by RefSeq, Dec 2015]
PHENOTYPE: Mice homozygous for a null mutation die prenatally. Heterozygous mice exhibit defects in pinna responses. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 42 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acsl3	A	C	1: 78,688,282	I142L	probably benign	Het
Adgra2	C	T	8: 27,111,088	P252L	probably damaging	Het
Akap6	A	G	12: 53,139,520	E1239G	probably benign	Het
Arhgef17	TGGAGGAGGAGGAGGAGG	TGGAGGAGGAGGAGG	7: 100,931,037		probably benign	Het
Btbd11	A	G	10: 85,640,596	T914A	possibly damaging	Het
Calml4	A	T	9: 62,871,266	D12V	probably damaging	Het
Car9	G	T	4: 43,512,439		probably null	Het
Ccar2	C	A	14: 70,140,109	V699L	possibly damaging	Het
Ccdc27	T	C	4: 154,041,769	M88V	unknown	Het
Ceacam15	T	C	7: 16,672,063	R188G	probably damaging	Het
Dcaf8	G	A	1: 172,174,052	R272H	probably benign	Het
Dchs1	A	G	7: 105,755,571	V2588A	probably benign	Het
Dst	G	A	1: 34,211,232	R1749H	probably damaging	Het
Exog	A	G	9: 119,462,506	Q283R	probably benign	Het
Fmnl1	A	T	11: 103,186,709		probably null	Het
Gramd1c	T	C	16: 43,990,722	D213G	probably damaging	Het
Iqgap1	A	G	7: 80,759,756		probably null	Het
Itgae	A	G	11: 73,125,362	Y799C	probably damaging	Het
Kalrn	T	C	16: 33,988,803	I903V	probably benign	Het
Kcnh1	A	G	1: 192,505,763	E844G	probably benign	Het
Khdc1a	A	T	1: 21,350,027	D3V	probably damaging	Het
Ly6g	T	C	15: 75,156,766	F25S	probably benign	Het
Mapk1ip1	G	A	7: 138,836,727		probably benign	Het
Mfsd3	A	G	15: 76,702,689	H243R	probably benign	Het
Mrgprb5	A	T	7: 48,168,330	V219E	probably damaging	Het
Nars2	G	A	7: 97,002,829	S209N	probably benign	Het
Nckap5	T	C	1: 126,026,710	T702A	probably damaging	Het
Olfr385	T	C	11: 73,589,543	N65S	possibly damaging	Het
Paf1	A	G	7: 28,398,832		probably benign	Het
Prl3d1	A	T	13: 27,098,710	R145*	probably null	Het
Rasl10b	G	A	11: 83,417,839		probably null	Het
Rnf13	T	A	3: 57,779,496	N103K	probably damaging	Het
Senp1	T	C	15: 98,075,853	S170G	probably benign	Het
Slc46a2	A	G	4: 59,914,620	L101P	probably damaging	Het
Tmem123	C	T	9: 7,791,106	T136M	probably damaging	Het
Tpo	T	A	12: 30,103,110	H415L	probably damaging	Het
Vipr2	A	G	12: 116,137,330	I255V	probably benign	Het
Zc3h11a	A	T	1: 133,633,803	V310E	probably damaging	Het
Zfp3	T	A	11: 70,772,636	C474S	probably damaging	Het
Zfp707	T	A	15: 75,974,616	C99S	probably damaging	Het
Zranb1	C	T	7: 132,971,333	P410S	probably damaging	Het
Zswim8	G	T	14: 20,710,748	R30L	probably damaging	Het

Other mutations in Mms22l

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01648:Mms22l	APN	4	24502805	missense	probably damaging	1.00
IGL02158:Mms22l	APN	4	24505349	missense	probably damaging	0.98
IGL02533:Mms22l	APN	4	24581099	splice site	probably benign
IGL02612:Mms22l	APN	4	24508482	missense	probably benign	0.03
IGL02685:Mms22l	APN	4	24591133	missense	probably benign
IGL03000:Mms22l	APN	4	24581161	missense	probably damaging	0.99
IGL03006:Mms22l	APN	4	24521253	missense	probably damaging	1.00
PIT4280001:Mms22l	UTSW	4	24581149	missense	probably benign	0.08
R0157:Mms22l	UTSW	4	24588224	missense	probably damaging	1.00
R0279:Mms22l	UTSW	4	24497867	missense	probably damaging	1.00
R0669:Mms22l	UTSW	4	24517223	missense	probably benign	0.00
R1056:Mms22l	UTSW	4	24586344	critical splice donor site	probably null
R1232:Mms22l	UTSW	4	24536274	missense	probably benign	0.24
R1543:Mms22l	UTSW	4	24591084	missense	probably benign	0.41
R1604:Mms22l	UTSW	4	24502804	missense	probably damaging	1.00
R1872:Mms22l	UTSW	4	24598807	missense	probably damaging	0.99
R1929:Mms22l	UTSW	4	24535936	unclassified	probably benign
R2024:Mms22l	UTSW	4	24588365	missense	probably damaging	1.00
R2081:Mms22l	UTSW	4	24536150	missense	probably damaging	1.00
R2104:Mms22l	UTSW	4	24591084	missense	probably benign	0.41
R2147:Mms22l	UTSW	4	24580063	nonsense	probably null
R2379:Mms22l	UTSW	4	24496929	missense	possibly damaging	0.87
R2496:Mms22l	UTSW	4	24521269	missense	probably benign	0.31
R3508:Mms22l	UTSW	4	24586224	missense	probably benign	0.01
R3625:Mms22l	UTSW	4	24505357	missense	probably damaging	1.00
R3789:Mms22l	UTSW	4	24517115	missense	possibly damaging	0.75
R4422:Mms22l	UTSW	4	24503008	missense	probably damaging	1.00
R4623:Mms22l	UTSW	4	24502792	nonsense	probably null
R4799:Mms22l	UTSW	4	24580052	critical splice acceptor site	probably null
R4825:Mms22l	UTSW	4	24536226	missense	probably damaging	1.00
R5236:Mms22l	UTSW	4	24588347	missense	probably benign	0.02
R5276:Mms22l	UTSW	4	24578774	missense	probably damaging	1.00
R5364:Mms22l	UTSW	4	24496882	unclassified	probably benign
R5394:Mms22l	UTSW	4	24517115	missense	possibly damaging	0.75
R6905:Mms22l	UTSW	4	24503107	missense	probably benign	0.00
R7206:Mms22l	UTSW	4	24591146	missense	probably benign	0.00
R7290:Mms22l	UTSW	4	24517139	missense	probably benign
R7425:Mms22l	UTSW	4	24596287	missense	probably benign	0.15
R7524:Mms22l	UTSW	4	24536138	missense	possibly damaging	0.89
R7536:Mms22l	UTSW	4	24581240	missense	probably damaging	0.99
R7722:Mms22l	UTSW	4	24517201	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TCCCAGAAGTCCTACTTGACGGTG -3'
(R):5'- TGTCTTCAGCAGGAAACCCAGC -3'

Sequencing Primer
(F):5'- GTCCTACTTGACGGTGAGAAG -3'
(R):5'- GGGAAATCCTGTTTCTAAGCTACC -3'

Posted On

2014-03-17