Incidental Mutation 'R1389:Paf1'
ID162529
Institutional Source Beutler Lab
Gene Symbol Paf1
Ensembl Gene ENSMUSG00000003437
Gene NamePaf1, RNA polymerase II complex component
Synonyms5730511K23Rik
MMRRC Submission 039451-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.912) question?
Stock #R1389 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location28392951-28399388 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) A to G at 28398832 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000147037 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003529] [ENSMUST00000040531] [ENSMUST00000207766] [ENSMUST00000208126] [ENSMUST00000208199]
Predicted Effect unknown
Transcript: ENSMUST00000003529
AA Change: E397G
SMART Domains Protein: ENSMUSP00000003529
Gene: ENSMUSG00000003437
AA Change: E397G

DomainStartEndE-ValueType
Pfam:Paf1 28 441 2.3e-154 PFAM
low complexity region 456 470 N/A INTRINSIC
low complexity region 476 511 N/A INTRINSIC
low complexity region 514 535 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000040531
SMART Domains Protein: ENSMUSP00000040486
Gene: ENSMUSG00000109336

DomainStartEndE-ValueType
low complexity region 81 90 N/A INTRINSIC
low complexity region 174 190 N/A INTRINSIC
low complexity region 200 211 N/A INTRINSIC
low complexity region 278 290 N/A INTRINSIC
SAM 296 359 1.02e-9 SMART
low complexity region 406 420 N/A INTRINSIC
low complexity region 433 461 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000122857
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132910
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143201
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145339
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146604
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146886
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146913
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152512
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154823
Predicted Effect probably benign
Transcript: ENSMUST00000207766
Predicted Effect probably benign
Transcript: ENSMUST00000208126
Predicted Effect probably benign
Transcript: ENSMUST00000208199
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.7%
  • 20x: 90.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a subunit of the polymerase associated factor (PAF1) complex. The PAF1 complex interacts with RNA polymerase II and plays a role in transcription elongation as well as histone modifications including ubiquitylation and methylation. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Feb 2012]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsl3 A C 1: 78,688,282 I142L probably benign Het
Adgra2 C T 8: 27,111,088 P252L probably damaging Het
Akap6 A G 12: 53,139,520 E1239G probably benign Het
Arhgef17 TGGAGGAGGAGGAGGAGG TGGAGGAGGAGGAGG 7: 100,931,037 probably benign Het
Btbd11 A G 10: 85,640,596 T914A possibly damaging Het
Calml4 A T 9: 62,871,266 D12V probably damaging Het
Car9 G T 4: 43,512,439 probably null Het
Ccar2 C A 14: 70,140,109 V699L possibly damaging Het
Ccdc27 T C 4: 154,041,769 M88V unknown Het
Ceacam15 T C 7: 16,672,063 R188G probably damaging Het
Dcaf8 G A 1: 172,174,052 R272H probably benign Het
Dchs1 A G 7: 105,755,571 V2588A probably benign Het
Dst G A 1: 34,211,232 R1749H probably damaging Het
Exog A G 9: 119,462,506 Q283R probably benign Het
Fmnl1 A T 11: 103,186,709 probably null Het
Gramd1c T C 16: 43,990,722 D213G probably damaging Het
Iqgap1 A G 7: 80,759,756 probably null Het
Itgae A G 11: 73,125,362 Y799C probably damaging Het
Kalrn T C 16: 33,988,803 I903V probably benign Het
Kcnh1 A G 1: 192,505,763 E844G probably benign Het
Khdc1a A T 1: 21,350,027 D3V probably damaging Het
Ly6g T C 15: 75,156,766 F25S probably benign Het
Mapk1ip1 G A 7: 138,836,727 probably benign Het
Mfsd3 A G 15: 76,702,689 H243R probably benign Het
Mms22l T A 4: 24,591,076 Y1016N probably damaging Het
Mrgprb5 A T 7: 48,168,330 V219E probably damaging Het
Nars2 G A 7: 97,002,829 S209N probably benign Het
Nckap5 T C 1: 126,026,710 T702A probably damaging Het
Olfr385 T C 11: 73,589,543 N65S possibly damaging Het
Prl3d1 A T 13: 27,098,710 R145* probably null Het
Rasl10b G A 11: 83,417,839 probably null Het
Rnf13 T A 3: 57,779,496 N103K probably damaging Het
Senp1 T C 15: 98,075,853 S170G probably benign Het
Slc46a2 A G 4: 59,914,620 L101P probably damaging Het
Tmem123 C T 9: 7,791,106 T136M probably damaging Het
Tpo T A 12: 30,103,110 H415L probably damaging Het
Vipr2 A G 12: 116,137,330 I255V probably benign Het
Zc3h11a A T 1: 133,633,803 V310E probably damaging Het
Zfp3 T A 11: 70,772,636 C474S probably damaging Het
Zfp707 T A 15: 75,974,616 C99S probably damaging Het
Zranb1 C T 7: 132,971,333 P410S probably damaging Het
Zswim8 G T 14: 20,710,748 R30L probably damaging Het
Other mutations in Paf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02117:Paf1 APN 7 28398690 unclassified probably benign
IGL02583:Paf1 APN 7 28396171 missense probably damaging 0.98
IGL02965:Paf1 APN 7 28396204 critical splice donor site probably null
IGL03117:Paf1 APN 7 28395056 missense possibly damaging 0.92
K3955:Paf1 UTSW 7 28396925 unclassified probably null
P0038:Paf1 UTSW 7 28396925 unclassified probably null
R0445:Paf1 UTSW 7 28395688 missense probably damaging 1.00
R1808:Paf1 UTSW 7 28396822 missense probably damaging 1.00
R2006:Paf1 UTSW 7 28395768 splice site probably null
R5213:Paf1 UTSW 7 28395972 missense possibly damaging 0.71
R5413:Paf1 UTSW 7 28396615 missense possibly damaging 0.82
R5419:Paf1 UTSW 7 28395670 missense possibly damaging 0.68
R5795:Paf1 UTSW 7 28396618 missense probably damaging 0.97
R7378:Paf1 UTSW 7 28396928 missense probably damaging 1.00
R7502:Paf1 UTSW 7 28395868 missense possibly damaging 0.91
R7629:Paf1 UTSW 7 28395068 missense probably damaging 1.00
R7896:Paf1 UTSW 7 28396647 missense probably damaging 1.00
R7979:Paf1 UTSW 7 28396647 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCTGGTTTCAGGAGGCACGAAAG -3'
(R):5'- CAATCACTGTCACTGTCAGCCTCAC -3'

Sequencing Primer
(F):5'- AGGCACGAAAGGCCCAG -3'
(R):5'- GTCAGCCTCACTGGAATCAGAG -3'
Posted On2014-03-17