Incidental Mutation 'R1389:Nars2'
ID 162532
Institutional Source Beutler Lab
Gene Symbol Nars2
Ensembl Gene ENSMUSG00000018995
Gene Name asparaginyl-tRNA synthetase 2 (mitochondrial)(putative)
Synonyms
MMRRC Submission 039451-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R1389 (G1)
Quality Score 225
Status Not validated
Chromosome 7
Chromosomal Location 96951505-97064758 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 97002829 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Asparagine at position 209 (S209N)
Ref Sequence ENSEMBL: ENSMUSP00000102777 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044466] [ENSMUST00000107159]
AlphaFold Q8BGV0
Predicted Effect probably benign
Transcript: ENSMUST00000044466
AA Change: S209N

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000044937
Gene: ENSMUSG00000018995
AA Change: S209N

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
Pfam:tRNA_anti-codon 44 118 2.4e-12 PFAM
Pfam:tRNA-synt_2 135 472 1.4e-100 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000107159
AA Change: S209N

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000102777
Gene: ENSMUSG00000018995
AA Change: S209N

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
Pfam:tRNA_anti-codon 44 118 7.6e-14 PFAM
Pfam:tRNA-synt_2 135 390 5.4e-53 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149204
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.7%
  • 20x: 90.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a putative member of the class II family of aminoacyl-tRNA synthetases. These enzymes play a critical role in protein biosynthesis by charging tRNAs with their cognate amino acids. This protein is encoded by the nuclear genome but is likely to be imported to the mitochondrion where it is thought to catalyze the ligation of asparagine to tRNA molecules. Mutations in this gene have been associated with combined oxidative phosphorylation deficiency 24 (COXPD24). [provided by RefSeq, Mar 2015]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsl3 A C 1: 78,688,282 I142L probably benign Het
Adgra2 C T 8: 27,111,088 P252L probably damaging Het
Akap6 A G 12: 53,139,520 E1239G probably benign Het
Arhgef17 TGGAGGAGGAGGAGGAGG TGGAGGAGGAGGAGG 7: 100,931,037 probably benign Het
Btbd11 A G 10: 85,640,596 T914A possibly damaging Het
Calml4 A T 9: 62,871,266 D12V probably damaging Het
Car9 G T 4: 43,512,439 probably null Het
Ccar2 C A 14: 70,140,109 V699L possibly damaging Het
Ccdc27 T C 4: 154,041,769 M88V unknown Het
Ceacam15 T C 7: 16,672,063 R188G probably damaging Het
Dcaf8 G A 1: 172,174,052 R272H probably benign Het
Dchs1 A G 7: 105,755,571 V2588A probably benign Het
Dst G A 1: 34,211,232 R1749H probably damaging Het
Exog A G 9: 119,462,506 Q283R probably benign Het
Fmnl1 A T 11: 103,186,709 probably null Het
Gramd1c T C 16: 43,990,722 D213G probably damaging Het
Iqgap1 A G 7: 80,759,756 probably null Het
Itgae A G 11: 73,125,362 Y799C probably damaging Het
Kalrn T C 16: 33,988,803 I903V probably benign Het
Kcnh1 A G 1: 192,505,763 E844G probably benign Het
Khdc1a A T 1: 21,350,027 D3V probably damaging Het
Ly6g T C 15: 75,156,766 F25S probably benign Het
Mapk1ip1 G A 7: 138,836,727 probably benign Het
Mfsd3 A G 15: 76,702,689 H243R probably benign Het
Mms22l T A 4: 24,591,076 Y1016N probably damaging Het
Mrgprb5 A T 7: 48,168,330 V219E probably damaging Het
Nckap5 T C 1: 126,026,710 T702A probably damaging Het
Olfr385 T C 11: 73,589,543 N65S possibly damaging Het
Paf1 A G 7: 28,398,832 probably benign Het
Prl3d1 A T 13: 27,098,710 R145* probably null Het
Rasl10b G A 11: 83,417,839 probably null Het
Rnf13 T A 3: 57,779,496 N103K probably damaging Het
Senp1 T C 15: 98,075,853 S170G probably benign Het
Slc46a2 A G 4: 59,914,620 L101P probably damaging Het
Tmem123 C T 9: 7,791,106 T136M probably damaging Het
Tpo T A 12: 30,103,110 H415L probably damaging Het
Vipr2 A G 12: 116,137,330 I255V probably benign Het
Zc3h11a A T 1: 133,633,803 V310E probably damaging Het
Zfp3 T A 11: 70,772,636 C474S probably damaging Het
Zfp707 T A 15: 75,974,616 C99S probably damaging Het
Zranb1 C T 7: 132,971,333 P410S probably damaging Het
Zswim8 G T 14: 20,710,748 R30L probably damaging Het
Other mutations in Nars2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00796:Nars2 APN 7 97031579 missense probably benign 0.00
IGL00796:Nars2 APN 7 97031580 missense probably benign 0.40
IGL00990:Nars2 APN 7 97002790 splice site probably benign
IGL02954:Nars2 APN 7 97039893 splice site probably null
IGL03256:Nars2 APN 7 97039910 missense possibly damaging 0.67
IGL03394:Nars2 APN 7 97040013 missense possibly damaging 0.94
R0600:Nars2 UTSW 7 97039923 missense probably damaging 1.00
R0943:Nars2 UTSW 7 96955931 splice site probably benign
R4076:Nars2 UTSW 7 96958094 missense probably damaging 0.99
R4397:Nars2 UTSW 7 96973564 critical splice donor site probably null
R4758:Nars2 UTSW 7 96973528 missense probably damaging 1.00
R4771:Nars2 UTSW 7 97035245 missense probably damaging 1.00
R4908:Nars2 UTSW 7 97023741 missense probably benign 0.07
R5162:Nars2 UTSW 7 97059820 utr 3 prime probably benign
R6209:Nars2 UTSW 7 97057521 missense probably benign 0.00
R7464:Nars2 UTSW 7 97039930 missense probably benign 0.40
R7979:Nars2 UTSW 7 97062661 missense probably damaging 1.00
R8284:Nars2 UTSW 7 96951638 utr 5 prime probably benign
R8885:Nars2 UTSW 7 97002888 missense probably damaging 0.98
R9614:Nars2 UTSW 7 97039918 missense probably damaging 0.99
R9658:Nars2 UTSW 7 97039971 missense probably benign 0.00
Z1176:Nars2 UTSW 7 96951897 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- GGCTGTCAGAACTGTCTACACAGGTAT -3'
(R):5'- AAGATTGCAACGTCACACTTTGCTTT -3'

Sequencing Primer
(F):5'- CTGTTTTAGGCGTATGAACTCC -3'
(R):5'- accactgagccatctttcc -3'
Posted On 2014-03-17