Incidental Mutation 'R1389:Calml4'
ID162539
Institutional Source Beutler Lab
Gene Symbol Calml4
Ensembl Gene ENSMUSG00000032246
Gene Namecalmodulin-like 4
Synonyms
MMRRC Submission 039451-MU
Accession Numbers
Is this an essential gene? Not available question?
Stock #R1389 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location62858080-62875921 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 62871266 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 12 (D12V)
Ref Sequence ENSEMBL: ENSMUSP00000132298 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034777] [ENSMUST00000163820] [ENSMUST00000213643] [ENSMUST00000214633] [ENSMUST00000215870] [ENSMUST00000215968]
Predicted Effect probably damaging
Transcript: ENSMUST00000034777
AA Change: D59V

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000034777
Gene: ENSMUSG00000032246
AA Change: D59V

DomainStartEndE-ValueType
EFh 12 40 2.9e1 SMART
EFh 48 76 2.42e0 SMART
EFh 85 113 3.31e0 SMART
Blast:EFh 121 149 3e-12 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156423
Predicted Effect probably damaging
Transcript: ENSMUST00000163820
AA Change: D12V

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000132298
Gene: ENSMUSG00000032246
AA Change: D12V

DomainStartEndE-ValueType
PDB:3CLN|A 7 100 9e-23 PDB
SCOP:d2pvba_ 17 100 3e-13 SMART
Blast:EFh 38 66 2e-10 BLAST
Blast:EFh 74 102 6e-13 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000213643
Predicted Effect probably damaging
Transcript: ENSMUST00000214633
AA Change: D12V

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
Predicted Effect probably damaging
Transcript: ENSMUST00000215870
AA Change: D59V

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)
Predicted Effect probably damaging
Transcript: ENSMUST00000215968
AA Change: D23V

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.7%
  • 20x: 90.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsl3 A C 1: 78,688,282 I142L probably benign Het
Adgra2 C T 8: 27,111,088 P252L probably damaging Het
Akap6 A G 12: 53,139,520 E1239G probably benign Het
Arhgef17 TGGAGGAGGAGGAGGAGG TGGAGGAGGAGGAGG 7: 100,931,037 probably benign Het
Btbd11 A G 10: 85,640,596 T914A possibly damaging Het
Car9 G T 4: 43,512,439 probably null Het
Ccar2 C A 14: 70,140,109 V699L possibly damaging Het
Ccdc27 T C 4: 154,041,769 M88V unknown Het
Ceacam15 T C 7: 16,672,063 R188G probably damaging Het
Dcaf8 G A 1: 172,174,052 R272H probably benign Het
Dchs1 A G 7: 105,755,571 V2588A probably benign Het
Dst G A 1: 34,211,232 R1749H probably damaging Het
Exog A G 9: 119,462,506 Q283R probably benign Het
Fmnl1 A T 11: 103,186,709 probably null Het
Gramd1c T C 16: 43,990,722 D213G probably damaging Het
Iqgap1 A G 7: 80,759,756 probably null Het
Itgae A G 11: 73,125,362 Y799C probably damaging Het
Kalrn T C 16: 33,988,803 I903V probably benign Het
Kcnh1 A G 1: 192,505,763 E844G probably benign Het
Khdc1a A T 1: 21,350,027 D3V probably damaging Het
Ly6g T C 15: 75,156,766 F25S probably benign Het
Mapk1ip1 G A 7: 138,836,727 probably benign Het
Mfsd3 A G 15: 76,702,689 H243R probably benign Het
Mms22l T A 4: 24,591,076 Y1016N probably damaging Het
Mrgprb5 A T 7: 48,168,330 V219E probably damaging Het
Nars2 G A 7: 97,002,829 S209N probably benign Het
Nckap5 T C 1: 126,026,710 T702A probably damaging Het
Olfr385 T C 11: 73,589,543 N65S possibly damaging Het
Paf1 A G 7: 28,398,832 probably benign Het
Prl3d1 A T 13: 27,098,710 R145* probably null Het
Rasl10b G A 11: 83,417,839 probably null Het
Rnf13 T A 3: 57,779,496 N103K probably damaging Het
Senp1 T C 15: 98,075,853 S170G probably benign Het
Slc46a2 A G 4: 59,914,620 L101P probably damaging Het
Tmem123 C T 9: 7,791,106 T136M probably damaging Het
Tpo T A 12: 30,103,110 H415L probably damaging Het
Vipr2 A G 12: 116,137,330 I255V probably benign Het
Zc3h11a A T 1: 133,633,803 V310E probably damaging Het
Zfp3 T A 11: 70,772,636 C474S probably damaging Het
Zfp707 T A 15: 75,974,616 C99S probably damaging Het
Zranb1 C T 7: 132,971,333 P410S probably damaging Het
Zswim8 G T 14: 20,710,748 R30L probably damaging Het
Other mutations in Calml4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00660:Calml4 APN 9 62875492 missense probably benign 0.00
IGL03131:Calml4 APN 9 62875483 missense probably benign 0.30
R1501:Calml4 UTSW 9 62871340 missense probably benign 0.25
Predicted Primers PCR Primer
(F):5'- GGGCTCTCCACTATGACAAAGTTGAG -3'
(R):5'- GTGAGTGAGCTTCTCTCCCAGTTTC -3'

Sequencing Primer
(F):5'- ccctttctctctttctcttccc -3'
(R):5'- TCATGAGTTTCGACCGCAG -3'
Posted On2014-03-17