Incidental Mutation 'R1389:Btbd11'
ID162543
Institutional Source Beutler Lab
Gene Symbol Btbd11
Ensembl Gene ENSMUSG00000020042
Gene NameBTB (POZ) domain containing 11
Synonyms6330404E16Rik
MMRRC Submission 039451-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.179) question?
Stock #R1389 (G1)
Quality Score167
Status Not validated
Chromosome10
Chromosomal Location85386814-85660292 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 85640596 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 914 (T914A)
Ref Sequence ENSEMBL: ENSMUSP00000100944 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020231] [ENSMUST00000105306] [ENSMUST00000105307]
Predicted Effect probably benign
Transcript: ENSMUST00000020231
SMART Domains Protein: ENSMUSP00000020231
Gene: ENSMUSG00000020042

DomainStartEndE-ValueType
low complexity region 101 109 N/A INTRINSIC
Blast:H2B 122 173 3e-9 BLAST
low complexity region 174 194 N/A INTRINSIC
Blast:H2A 195 261 6e-37 BLAST
low complexity region 262 285 N/A INTRINSIC
low complexity region 292 344 N/A INTRINSIC
Blast:H2A 350 384 9e-16 BLAST
ANK 608 637 2.74e-7 SMART
ANK 654 683 7.3e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000105306
AA Change: T445A

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000100943
Gene: ENSMUSG00000020042
AA Change: T445A

DomainStartEndE-ValueType
ANK 139 168 2.74e-7 SMART
ANK 185 214 7.3e-3 SMART
ANK 223 252 1.05e-3 SMART
ANK 266 296 2.21e3 SMART
BTB 459 558 5.38e-21 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000105307
AA Change: T914A

PolyPhen 2 Score 0.757 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000100944
Gene: ENSMUSG00000020042
AA Change: T914A

DomainStartEndE-ValueType
low complexity region 101 109 N/A INTRINSIC
low complexity region 174 194 N/A INTRINSIC
Blast:H2A 195 261 5e-37 BLAST
low complexity region 262 285 N/A INTRINSIC
low complexity region 292 344 N/A INTRINSIC
Blast:H2A 350 384 1e-15 BLAST
ANK 608 637 2.74e-7 SMART
ANK 654 683 7.3e-3 SMART
ANK 692 721 1.05e-3 SMART
ANK 735 765 2.21e3 SMART
BTB 928 1027 5.38e-21 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128338
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145323
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156123
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.7%
  • 20x: 90.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsl3 A C 1: 78,688,282 I142L probably benign Het
Adgra2 C T 8: 27,111,088 P252L probably damaging Het
Akap6 A G 12: 53,139,520 E1239G probably benign Het
Arhgef17 TGGAGGAGGAGGAGGAGG TGGAGGAGGAGGAGG 7: 100,931,037 probably benign Het
Calml4 A T 9: 62,871,266 D12V probably damaging Het
Car9 G T 4: 43,512,439 probably null Het
Ccar2 C A 14: 70,140,109 V699L possibly damaging Het
Ccdc27 T C 4: 154,041,769 M88V unknown Het
Ceacam15 T C 7: 16,672,063 R188G probably damaging Het
Dcaf8 G A 1: 172,174,052 R272H probably benign Het
Dchs1 A G 7: 105,755,571 V2588A probably benign Het
Dst G A 1: 34,211,232 R1749H probably damaging Het
Exog A G 9: 119,462,506 Q283R probably benign Het
Fmnl1 A T 11: 103,186,709 probably null Het
Gramd1c T C 16: 43,990,722 D213G probably damaging Het
Iqgap1 A G 7: 80,759,756 probably null Het
Itgae A G 11: 73,125,362 Y799C probably damaging Het
Kalrn T C 16: 33,988,803 I903V probably benign Het
Kcnh1 A G 1: 192,505,763 E844G probably benign Het
Khdc1a A T 1: 21,350,027 D3V probably damaging Het
Ly6g T C 15: 75,156,766 F25S probably benign Het
Mapk1ip1 G A 7: 138,836,727 probably benign Het
Mfsd3 A G 15: 76,702,689 H243R probably benign Het
Mms22l T A 4: 24,591,076 Y1016N probably damaging Het
Mrgprb5 A T 7: 48,168,330 V219E probably damaging Het
Nars2 G A 7: 97,002,829 S209N probably benign Het
Nckap5 T C 1: 126,026,710 T702A probably damaging Het
Olfr385 T C 11: 73,589,543 N65S possibly damaging Het
Paf1 A G 7: 28,398,832 probably benign Het
Prl3d1 A T 13: 27,098,710 R145* probably null Het
Rasl10b G A 11: 83,417,839 probably null Het
Rnf13 T A 3: 57,779,496 N103K probably damaging Het
Senp1 T C 15: 98,075,853 S170G probably benign Het
Slc46a2 A G 4: 59,914,620 L101P probably damaging Het
Tmem123 C T 9: 7,791,106 T136M probably damaging Het
Tpo T A 12: 30,103,110 H415L probably damaging Het
Vipr2 A G 12: 116,137,330 I255V probably benign Het
Zc3h11a A T 1: 133,633,803 V310E probably damaging Het
Zfp3 T A 11: 70,772,636 C474S probably damaging Het
Zfp707 T A 15: 75,974,616 C99S probably damaging Het
Zranb1 C T 7: 132,971,333 P410S probably damaging Het
Zswim8 G T 14: 20,710,748 R30L probably damaging Het
Other mutations in Btbd11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00666:Btbd11 APN 10 85629216 missense possibly damaging 0.87
IGL01143:Btbd11 APN 10 85654471 splice site probably benign
IGL01365:Btbd11 APN 10 85633816 missense possibly damaging 0.75
IGL01409:Btbd11 APN 10 85658165 missense possibly damaging 0.88
IGL01531:Btbd11 APN 10 85629205 splice site probably benign
IGL01593:Btbd11 APN 10 85654475 splice site probably benign
IGL01751:Btbd11 APN 10 85654502 missense probably damaging 1.00
IGL01752:Btbd11 APN 10 85654502 missense probably damaging 1.00
IGL02041:Btbd11 APN 10 85387554 missense unknown
IGL02486:Btbd11 APN 10 85640555 missense probably damaging 1.00
IGL02597:Btbd11 APN 10 85633801 missense probably damaging 1.00
IGL02957:Btbd11 APN 10 85633837 missense probably damaging 1.00
IGL02957:Btbd11 APN 10 85631286 splice site probably benign
IGL02967:Btbd11 APN 10 85633782 missense probably benign 0.11
IGL02975:Btbd11 APN 10 85631343 missense probably benign 0.16
IGL03078:Btbd11 APN 10 85632163 missense probably damaging 1.00
IGL03130:Btbd11 APN 10 85388483 splice site probably null
IGL03335:Btbd11 APN 10 85658358 utr 3 prime probably benign
R0024:Btbd11 UTSW 10 85387447 missense unknown
R0599:Btbd11 UTSW 10 85658336 missense probably damaging 1.00
R0655:Btbd11 UTSW 10 85645526 missense probably damaging 1.00
R0660:Btbd11 UTSW 10 85388370 missense possibly damaging 0.65
R0664:Btbd11 UTSW 10 85388370 missense possibly damaging 0.65
R1155:Btbd11 UTSW 10 85629291 missense probably damaging 1.00
R1244:Btbd11 UTSW 10 85387363 missense unknown
R1418:Btbd11 UTSW 10 85645578 missense probably damaging 1.00
R1703:Btbd11 UTSW 10 85387384 missense unknown
R1957:Btbd11 UTSW 10 85633699 missense probably damaging 1.00
R2519:Btbd11 UTSW 10 85651611 missense probably damaging 1.00
R3716:Btbd11 UTSW 10 85561528 missense probably damaging 1.00
R3915:Btbd11 UTSW 10 85632270 missense probably damaging 1.00
R4738:Btbd11 UTSW 10 85627248 nonsense probably null
R4782:Btbd11 UTSW 10 85654550 missense probably damaging 1.00
R4846:Btbd11 UTSW 10 85629266 missense probably damaging 1.00
R4887:Btbd11 UTSW 10 85387378 missense unknown
R4960:Btbd11 UTSW 10 85651662 missense probably benign 0.34
R5224:Btbd11 UTSW 10 85645522 small deletion probably benign
R5341:Btbd11 UTSW 10 85387372 missense unknown
R5713:Btbd11 UTSW 10 85651652 missense probably damaging 1.00
R6046:Btbd11 UTSW 10 85388083 missense unknown
R6461:Btbd11 UTSW 10 85640564 missense probably damaging 1.00
R6809:Btbd11 UTSW 10 85631376 missense probably benign 0.01
R7069:Btbd11 UTSW 10 85387656 missense unknown
R7130:Btbd11 UTSW 10 85387555 missense unknown
R7202:Btbd11 UTSW 10 85387765 missense unknown
R7275:Btbd11 UTSW 10 85654482 missense probably damaging 1.00
R7489:Btbd11 UTSW 10 85627215 missense probably damaging 1.00
X0020:Btbd11 UTSW 10 85631352 missense possibly damaging 0.86
Z1088:Btbd11 UTSW 10 85387857 missense probably benign 0.23
Predicted Primers PCR Primer
(F):5'- TGCGAGCAGGTTTCTACAGTGTC -3'
(R):5'- GTGTCCCCAGTGTCAGTGAAAGAG -3'

Sequencing Primer
(F):5'- AGGTTTCTACAGTGTCAACCTG -3'
(R):5'- AGATTTACCACCTGCTGAAGG -3'
Posted On2014-03-17