Incidental Mutation 'R1389:Olfr385'
ID162546
Institutional Source Beutler Lab
Gene Symbol Olfr385
Ensembl Gene ENSMUSG00000095095
Gene Nameolfactory receptor 385
SynonymsMOR135-3, GA_x6K02T2P1NL-3760313-3759375
MMRRC Submission 039451-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.119) question?
Stock #R1389 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location73588302-73593008 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 73589543 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 65 (N65S)
Ref Sequence ENSEMBL: ENSMUSP00000149293 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071553] [ENSMUST00000215689]
Predicted Effect possibly damaging
Transcript: ENSMUST00000071553
AA Change: N65S

PolyPhen 2 Score 0.882 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000071484
Gene: ENSMUSG00000095095
AA Change: N65S

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 6.1e-55 PFAM
Pfam:7TM_GPCR_Srsx 35 305 1.7e-6 PFAM
Pfam:7tm_1 41 290 2.2e-23 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000215689
AA Change: N65S

PolyPhen 2 Score 0.882 (Sensitivity: 0.82; Specificity: 0.94)
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.7%
  • 20x: 90.6%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsl3 A C 1: 78,688,282 I142L probably benign Het
Adgra2 C T 8: 27,111,088 P252L probably damaging Het
Akap6 A G 12: 53,139,520 E1239G probably benign Het
Arhgef17 TGGAGGAGGAGGAGGAGG TGGAGGAGGAGGAGG 7: 100,931,037 probably benign Het
Btbd11 A G 10: 85,640,596 T914A possibly damaging Het
Calml4 A T 9: 62,871,266 D12V probably damaging Het
Car9 G T 4: 43,512,439 probably null Het
Ccar2 C A 14: 70,140,109 V699L possibly damaging Het
Ccdc27 T C 4: 154,041,769 M88V unknown Het
Ceacam15 T C 7: 16,672,063 R188G probably damaging Het
Dcaf8 G A 1: 172,174,052 R272H probably benign Het
Dchs1 A G 7: 105,755,571 V2588A probably benign Het
Dst G A 1: 34,211,232 R1749H probably damaging Het
Exog A G 9: 119,462,506 Q283R probably benign Het
Fmnl1 A T 11: 103,186,709 probably null Het
Gramd1c T C 16: 43,990,722 D213G probably damaging Het
Iqgap1 A G 7: 80,759,756 probably null Het
Itgae A G 11: 73,125,362 Y799C probably damaging Het
Kalrn T C 16: 33,988,803 I903V probably benign Het
Kcnh1 A G 1: 192,505,763 E844G probably benign Het
Khdc1a A T 1: 21,350,027 D3V probably damaging Het
Ly6g T C 15: 75,156,766 F25S probably benign Het
Mapk1ip1 G A 7: 138,836,727 probably benign Het
Mfsd3 A G 15: 76,702,689 H243R probably benign Het
Mms22l T A 4: 24,591,076 Y1016N probably damaging Het
Mrgprb5 A T 7: 48,168,330 V219E probably damaging Het
Nars2 G A 7: 97,002,829 S209N probably benign Het
Nckap5 T C 1: 126,026,710 T702A probably damaging Het
Paf1 A G 7: 28,398,832 probably benign Het
Prl3d1 A T 13: 27,098,710 R145* probably null Het
Rasl10b G A 11: 83,417,839 probably null Het
Rnf13 T A 3: 57,779,496 N103K probably damaging Het
Senp1 T C 15: 98,075,853 S170G probably benign Het
Slc46a2 A G 4: 59,914,620 L101P probably damaging Het
Tmem123 C T 9: 7,791,106 T136M probably damaging Het
Tpo T A 12: 30,103,110 H415L probably damaging Het
Vipr2 A G 12: 116,137,330 I255V probably benign Het
Zc3h11a A T 1: 133,633,803 V310E probably damaging Het
Zfp3 T A 11: 70,772,636 C474S probably damaging Het
Zfp707 T A 15: 75,974,616 C99S probably damaging Het
Zranb1 C T 7: 132,971,333 P410S probably damaging Het
Zswim8 G T 14: 20,710,748 R30L probably damaging Het
Other mutations in Olfr385
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01570:Olfr385 APN 11 73589383 missense probably benign 0.34
IGL02045:Olfr385 APN 11 73589232 missense probably damaging 1.00
IGL02324:Olfr385 APN 11 73589255 missense probably benign 0.02
IGL02328:Olfr385 APN 11 73589255 missense probably benign 0.02
IGL02562:Olfr385 APN 11 73589411 missense probably benign
IGL02715:Olfr385 APN 11 73589121 missense probably benign 0.00
IGL03182:Olfr385 APN 11 73589442 missense probably benign 0.04
IGL03048:Olfr385 UTSW 11 73589005 missense possibly damaging 0.56
R0346:Olfr385 UTSW 11 73589457 missense probably damaging 1.00
R0675:Olfr385 UTSW 11 73589252 missense probably damaging 1.00
R0751:Olfr385 UTSW 11 73589144 missense probably benign 0.02
R1220:Olfr385 UTSW 11 73589377 nonsense probably null
R1484:Olfr385 UTSW 11 73589361 missense possibly damaging 0.91
R1619:Olfr385 UTSW 11 73589292 missense probably damaging 1.00
R2290:Olfr385 UTSW 11 73588919 missense probably benign 0.37
R3713:Olfr385 UTSW 11 73588905 missense probably damaging 1.00
R3781:Olfr385 UTSW 11 73589013 missense probably damaging 1.00
R3781:Olfr385 UTSW 11 73589368 nonsense probably null
R3782:Olfr385 UTSW 11 73589013 missense probably damaging 1.00
R3782:Olfr385 UTSW 11 73589368 nonsense probably null
R4402:Olfr385 UTSW 11 73589255 missense probably benign 0.02
R4721:Olfr385 UTSW 11 73589447 missense probably damaging 1.00
R5157:Olfr385 UTSW 11 73589723 missense probably damaging 1.00
R5995:Olfr385 UTSW 11 73589250 missense probably benign
R6373:Olfr385 UTSW 11 73588898 missense probably benign 0.42
R6658:Olfr385 UTSW 11 73589048 missense probably damaging 0.99
R7046:Olfr385 UTSW 11 73589732 missense probably benign
R7096:Olfr385 UTSW 11 73589637 missense probably benign 0.03
R7238:Olfr385 UTSW 11 73589735 start codon destroyed probably null 0.99
R7537:Olfr385 UTSW 11 73589268 missense probably benign 0.04
R7548:Olfr385 UTSW 11 73588976 missense possibly damaging 0.56
R7888:Olfr385 UTSW 11 73589528 missense probably damaging 0.99
R7971:Olfr385 UTSW 11 73589528 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AGCGGTCATAGGCCATGAACATAAG -3'
(R):5'- TGACCCAGGATGAGCACATAGCAG -3'

Sequencing Primer
(F):5'- GCCATGAACATAAGAAGAAAGTTCTC -3'
(R):5'- GGAGTTTTGGCATCATAACCAC -3'
Posted On2014-03-17