Incidental Mutation 'R1389:Rasl10b'
ID162547
Institutional Source Beutler Lab
Gene Symbol Rasl10b
Ensembl Gene ENSMUSG00000020684
Gene NameRAS-like, family 10, member B
SynonymsB230331P10Rik, VTS58635
MMRRC Submission 039451-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.108) question?
Stock #R1389 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location83409137-83421039 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) G to A at 83417839 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000135803 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021022] [ENSMUST00000021022] [ENSMUST00000052521] [ENSMUST00000108140] [ENSMUST00000108140] [ENSMUST00000147301] [ENSMUST00000164425] [ENSMUST00000164425] [ENSMUST00000175848] [ENSMUST00000175848]
Predicted Effect probably null
Transcript: ENSMUST00000021022
SMART Domains Protein: ENSMUSP00000021022
Gene: ENSMUSG00000020684

DomainStartEndE-ValueType
Pfam:Miro 6 131 2.7e-16 PFAM
Pfam:Ras 6 178 1e-24 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000021022
SMART Domains Protein: ENSMUSP00000021022
Gene: ENSMUSG00000020684

DomainStartEndE-ValueType
Pfam:Miro 6 131 2.7e-16 PFAM
Pfam:Ras 6 178 1e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000052521
SMART Domains Protein: ENSMUSP00000051907
Gene: ENSMUSG00000020686

DomainStartEndE-ValueType
low complexity region 4 19 N/A INTRINSIC
CH 34 154 2.15e-15 SMART
low complexity region 167 200 N/A INTRINSIC
Pfam:GAS2 206 274 1.2e-35 PFAM
low complexity region 444 460 N/A INTRINSIC
low complexity region 760 775 N/A INTRINSIC
low complexity region 817 827 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000108140
SMART Domains Protein: ENSMUSP00000103775
Gene: ENSMUSG00000020684

DomainStartEndE-ValueType
Pfam:Miro 6 131 2.7e-16 PFAM
Pfam:Ras 6 178 1e-24 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000108140
SMART Domains Protein: ENSMUSP00000103775
Gene: ENSMUSG00000020684

DomainStartEndE-ValueType
Pfam:Miro 6 131 2.7e-16 PFAM
Pfam:Ras 6 178 1e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000147301
SMART Domains Protein: ENSMUSP00000119454
Gene: ENSMUSG00000020686

DomainStartEndE-ValueType
low complexity region 4 19 N/A INTRINSIC
CH 34 154 2.15e-15 SMART
low complexity region 167 185 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000164425
SMART Domains Protein: ENSMUSP00000132696
Gene: ENSMUSG00000020684

DomainStartEndE-ValueType
Pfam:Ras 6 178 6.6e-25 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000164425
SMART Domains Protein: ENSMUSP00000132696
Gene: ENSMUSG00000020684

DomainStartEndE-ValueType
Pfam:Ras 6 178 6.6e-25 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000175848
SMART Domains Protein: ENSMUSP00000135803
Gene: ENSMUSG00000020684

DomainStartEndE-ValueType
Pfam:Ras 6 120 2.3e-12 PFAM
Pfam:Miro 6 123 8.2e-13 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000175848
SMART Domains Protein: ENSMUSP00000135803
Gene: ENSMUSG00000020684

DomainStartEndE-ValueType
Pfam:Ras 6 120 2.3e-12 PFAM
Pfam:Miro 6 123 8.2e-13 PFAM
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.7%
  • 20x: 90.6%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele have smaller than normal large dense-core vesicles in atrial myocytes and exhibit impaired atrial natriuretic peptide secretion. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsl3 A C 1: 78,688,282 I142L probably benign Het
Adgra2 C T 8: 27,111,088 P252L probably damaging Het
Akap6 A G 12: 53,139,520 E1239G probably benign Het
Arhgef17 TGGAGGAGGAGGAGGAGG TGGAGGAGGAGGAGG 7: 100,931,037 probably benign Het
Btbd11 A G 10: 85,640,596 T914A possibly damaging Het
Calml4 A T 9: 62,871,266 D12V probably damaging Het
Car9 G T 4: 43,512,439 probably null Het
Ccar2 C A 14: 70,140,109 V699L possibly damaging Het
Ccdc27 T C 4: 154,041,769 M88V unknown Het
Ceacam15 T C 7: 16,672,063 R188G probably damaging Het
Dcaf8 G A 1: 172,174,052 R272H probably benign Het
Dchs1 A G 7: 105,755,571 V2588A probably benign Het
Dst G A 1: 34,211,232 R1749H probably damaging Het
Exog A G 9: 119,462,506 Q283R probably benign Het
Fmnl1 A T 11: 103,186,709 probably null Het
Gramd1c T C 16: 43,990,722 D213G probably damaging Het
Iqgap1 A G 7: 80,759,756 probably null Het
Itgae A G 11: 73,125,362 Y799C probably damaging Het
Kalrn T C 16: 33,988,803 I903V probably benign Het
Kcnh1 A G 1: 192,505,763 E844G probably benign Het
Khdc1a A T 1: 21,350,027 D3V probably damaging Het
Ly6g T C 15: 75,156,766 F25S probably benign Het
Mapk1ip1 G A 7: 138,836,727 probably benign Het
Mfsd3 A G 15: 76,702,689 H243R probably benign Het
Mms22l T A 4: 24,591,076 Y1016N probably damaging Het
Mrgprb5 A T 7: 48,168,330 V219E probably damaging Het
Nars2 G A 7: 97,002,829 S209N probably benign Het
Nckap5 T C 1: 126,026,710 T702A probably damaging Het
Olfr385 T C 11: 73,589,543 N65S possibly damaging Het
Paf1 A G 7: 28,398,832 probably benign Het
Prl3d1 A T 13: 27,098,710 R145* probably null Het
Rnf13 T A 3: 57,779,496 N103K probably damaging Het
Senp1 T C 15: 98,075,853 S170G probably benign Het
Slc46a2 A G 4: 59,914,620 L101P probably damaging Het
Tmem123 C T 9: 7,791,106 T136M probably damaging Het
Tpo T A 12: 30,103,110 H415L probably damaging Het
Vipr2 A G 12: 116,137,330 I255V probably benign Het
Zc3h11a A T 1: 133,633,803 V310E probably damaging Het
Zfp3 T A 11: 70,772,636 C474S probably damaging Het
Zfp707 T A 15: 75,974,616 C99S probably damaging Het
Zranb1 C T 7: 132,971,333 P410S probably damaging Het
Zswim8 G T 14: 20,710,748 R30L probably damaging Het
Other mutations in Rasl10b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02003:Rasl10b APN 11 83417853 missense probably damaging 1.00
R0378:Rasl10b UTSW 11 83418693 missense probably damaging 1.00
R0772:Rasl10b UTSW 11 83417839 splice site probably null
R0773:Rasl10b UTSW 11 83417839 splice site probably null
R0829:Rasl10b UTSW 11 83417839 splice site probably null
R0830:Rasl10b UTSW 11 83417839 splice site probably null
R0831:Rasl10b UTSW 11 83417839 splice site probably null
R1363:Rasl10b UTSW 11 83417839 splice site probably null
R1364:Rasl10b UTSW 11 83417839 splice site probably null
R1365:Rasl10b UTSW 11 83417839 splice site probably null
R1366:Rasl10b UTSW 11 83417839 splice site probably null
R1367:Rasl10b UTSW 11 83417839 splice site probably null
R1368:Rasl10b UTSW 11 83417839 splice site probably null
R3771:Rasl10b UTSW 11 83418523 missense probably benign 0.04
R4925:Rasl10b UTSW 11 83412679 missense probably damaging 1.00
R5625:Rasl10b UTSW 11 83418814 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCTCACAAAATAGTGTGGTGGGC -3'
(R):5'- TGTACCCCTCTTTTGGAGACAGGC -3'

Sequencing Primer
(F):5'- CCAGGAAGTAACCAGCTTGTG -3'
(R):5'- TTTTGGAGACAGGCCAGCATC -3'
Posted On2014-03-17