Incidental Mutation 'R1389:Ccar2'
ID162557
Institutional Source Beutler Lab
Gene Symbol Ccar2
Ensembl Gene ENSMUSG00000033712
Gene Namecell cycle activator and apoptosis regulator 2
Synonyms2610301G19Rik
MMRRC Submission 039451-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.545) question?
Stock #R1389 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location70138164-70153811 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 70140109 bp
ZygosityHeterozygous
Amino Acid Change Valine to Leucine at position 699 (V699L)
Ref Sequence ENSEMBL: ENSMUSP00000036924 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022680] [ENSMUST00000035612]
Predicted Effect probably benign
Transcript: ENSMUST00000022680
SMART Domains Protein: ENSMUSP00000022680
Gene: ENSMUSG00000022089

DomainStartEndE-ValueType
BAR 5 225 2.05e-55 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000035612
AA Change: V699L

PolyPhen 2 Score 0.460 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000036924
Gene: ENSMUSG00000033712
AA Change: V699L

DomainStartEndE-ValueType
low complexity region 23 37 N/A INTRINSIC
Pfam:S1-like 55 112 1.3e-29 PFAM
DBC1 339 462 8.48e-73 SMART
low complexity region 496 507 N/A INTRINSIC
low complexity region 534 545 N/A INTRINSIC
low complexity region 563 601 N/A INTRINSIC
low complexity region 627 640 N/A INTRINSIC
low complexity region 647 660 N/A INTRINSIC
SCOP:d2mysb_ 703 747 2e-3 SMART
Blast:HDc 704 758 7e-7 BLAST
coiled coil region 828 898 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227589
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.7%
  • 20x: 90.6%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous null mice on a high fat diet are resistant to hepatic steatosis and associated liver inflammation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsl3 A C 1: 78,688,282 I142L probably benign Het
Adgra2 C T 8: 27,111,088 P252L probably damaging Het
Akap6 A G 12: 53,139,520 E1239G probably benign Het
Arhgef17 TGGAGGAGGAGGAGGAGG TGGAGGAGGAGGAGG 7: 100,931,037 probably benign Het
Btbd11 A G 10: 85,640,596 T914A possibly damaging Het
Calml4 A T 9: 62,871,266 D12V probably damaging Het
Car9 G T 4: 43,512,439 probably null Het
Ccdc27 T C 4: 154,041,769 M88V unknown Het
Ceacam15 T C 7: 16,672,063 R188G probably damaging Het
Dcaf8 G A 1: 172,174,052 R272H probably benign Het
Dchs1 A G 7: 105,755,571 V2588A probably benign Het
Dst G A 1: 34,211,232 R1749H probably damaging Het
Exog A G 9: 119,462,506 Q283R probably benign Het
Fmnl1 A T 11: 103,186,709 probably null Het
Gramd1c T C 16: 43,990,722 D213G probably damaging Het
Iqgap1 A G 7: 80,759,756 probably null Het
Itgae A G 11: 73,125,362 Y799C probably damaging Het
Kalrn T C 16: 33,988,803 I903V probably benign Het
Kcnh1 A G 1: 192,505,763 E844G probably benign Het
Khdc1a A T 1: 21,350,027 D3V probably damaging Het
Ly6g T C 15: 75,156,766 F25S probably benign Het
Mapk1ip1 G A 7: 138,836,727 probably benign Het
Mfsd3 A G 15: 76,702,689 H243R probably benign Het
Mms22l T A 4: 24,591,076 Y1016N probably damaging Het
Mrgprb5 A T 7: 48,168,330 V219E probably damaging Het
Nars2 G A 7: 97,002,829 S209N probably benign Het
Nckap5 T C 1: 126,026,710 T702A probably damaging Het
Olfr385 T C 11: 73,589,543 N65S possibly damaging Het
Paf1 A G 7: 28,398,832 probably benign Het
Prl3d1 A T 13: 27,098,710 R145* probably null Het
Rasl10b G A 11: 83,417,839 probably null Het
Rnf13 T A 3: 57,779,496 N103K probably damaging Het
Senp1 T C 15: 98,075,853 S170G probably benign Het
Slc46a2 A G 4: 59,914,620 L101P probably damaging Het
Tmem123 C T 9: 7,791,106 T136M probably damaging Het
Tpo T A 12: 30,103,110 H415L probably damaging Het
Vipr2 A G 12: 116,137,330 I255V probably benign Het
Zc3h11a A T 1: 133,633,803 V310E probably damaging Het
Zfp3 T A 11: 70,772,636 C474S probably damaging Het
Zfp707 T A 15: 75,974,616 C99S probably damaging Het
Zranb1 C T 7: 132,971,333 P410S probably damaging Het
Zswim8 G T 14: 20,710,748 R30L probably damaging Het
Other mutations in Ccar2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00503:Ccar2 APN 14 70142531 nonsense probably null
IGL01351:Ccar2 APN 14 70145862 missense probably benign 0.03
IGL01450:Ccar2 APN 14 70139751 splice site probably benign
IGL02306:Ccar2 APN 14 70142022 missense probably benign 0.01
IGL03403:Ccar2 APN 14 70140068 missense probably damaging 1.00
R0332:Ccar2 UTSW 14 70141935 splice site probably benign
R0502:Ccar2 UTSW 14 70140982 missense probably benign 0.00
R0827:Ccar2 UTSW 14 70139838 missense probably benign 0.00
R1022:Ccar2 UTSW 14 70140515 missense probably damaging 1.00
R1024:Ccar2 UTSW 14 70140515 missense probably damaging 1.00
R1160:Ccar2 UTSW 14 70139769 missense probably benign 0.42
R1258:Ccar2 UTSW 14 70152673 missense probably benign 0.24
R1532:Ccar2 UTSW 14 70142956 missense probably benign 0.01
R1870:Ccar2 UTSW 14 70140497 missense probably damaging 1.00
R2127:Ccar2 UTSW 14 70139651 missense probably benign 0.33
R4233:Ccar2 UTSW 14 70151091 missense possibly damaging 0.76
R4569:Ccar2 UTSW 14 70151910 unclassified probably null
R4799:Ccar2 UTSW 14 70139554 missense probably damaging 0.99
R5026:Ccar2 UTSW 14 70142502 missense possibly damaging 0.89
R5435:Ccar2 UTSW 14 70139327 missense probably damaging 1.00
R5893:Ccar2 UTSW 14 70151351 missense probably benign 0.28
R6446:Ccar2 UTSW 14 70143069 missense probably benign 0.31
R6594:Ccar2 UTSW 14 70140476 missense probably damaging 1.00
R6648:Ccar2 UTSW 14 70139225 missense probably benign 0.29
R7103:Ccar2 UTSW 14 70141977 missense probably damaging 0.99
R7594:Ccar2 UTSW 14 70141794 nonsense probably null
R7679:Ccar2 UTSW 14 70139235 nonsense probably null
V5088:Ccar2 UTSW 14 70151289 missense probably damaging 0.99
V5622:Ccar2 UTSW 14 70151289 missense probably damaging 0.99
V5622:Ccar2 UTSW 14 70151289 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CTGTTTGGCCTACAGAAAACACAGC -3'
(R):5'- TGGGAATGTGCCCACAGAAACC -3'

Sequencing Primer
(F):5'- ATGCCTGCATCAGGGAGAC -3'
(R):5'- ACCTGTAGCCCCAGCTC -3'
Posted On2014-03-17