Incidental Mutation 'R1389:Ly6g'
ID162558
Institutional Source Beutler Lab
Gene Symbol Ly6g
Ensembl Gene ENSMUSG00000022582
Gene Namelymphocyte antigen 6 complex, locus G
SynonymsGr1, Ly-6G, Gr-1
MMRRC Submission 039451-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.060) question?
Stock #R1389 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location75155240-75159126 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 75156766 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 25 (F25S)
Ref Sequence ENSEMBL: ENSMUSP00000023246 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023246] [ENSMUST00000190262]
Predicted Effect probably benign
Transcript: ENSMUST00000023246
AA Change: F25S

PolyPhen 2 Score 0.101 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000023246
Gene: ENSMUSG00000022582
AA Change: F25S

DomainStartEndE-ValueType
LU 4 95 1.64e-33 SMART
low complexity region 97 107 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000190262
AA Change: F48S

PolyPhen 2 Score 0.037 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000140173
Gene: ENSMUSG00000022582
AA Change: F48S

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
LU 27 118 8.2e-36 SMART
low complexity region 120 130 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.7%
  • 20x: 90.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsl3 A C 1: 78,688,282 I142L probably benign Het
Adgra2 C T 8: 27,111,088 P252L probably damaging Het
Akap6 A G 12: 53,139,520 E1239G probably benign Het
Arhgef17 TGGAGGAGGAGGAGGAGG TGGAGGAGGAGGAGG 7: 100,931,037 probably benign Het
Btbd11 A G 10: 85,640,596 T914A possibly damaging Het
Calml4 A T 9: 62,871,266 D12V probably damaging Het
Car9 G T 4: 43,512,439 probably null Het
Ccar2 C A 14: 70,140,109 V699L possibly damaging Het
Ccdc27 T C 4: 154,041,769 M88V unknown Het
Ceacam15 T C 7: 16,672,063 R188G probably damaging Het
Dcaf8 G A 1: 172,174,052 R272H probably benign Het
Dchs1 A G 7: 105,755,571 V2588A probably benign Het
Dst G A 1: 34,211,232 R1749H probably damaging Het
Exog A G 9: 119,462,506 Q283R probably benign Het
Fmnl1 A T 11: 103,186,709 probably null Het
Gramd1c T C 16: 43,990,722 D213G probably damaging Het
Iqgap1 A G 7: 80,759,756 probably null Het
Itgae A G 11: 73,125,362 Y799C probably damaging Het
Kalrn T C 16: 33,988,803 I903V probably benign Het
Kcnh1 A G 1: 192,505,763 E844G probably benign Het
Khdc1a A T 1: 21,350,027 D3V probably damaging Het
Mapk1ip1 G A 7: 138,836,727 probably benign Het
Mfsd3 A G 15: 76,702,689 H243R probably benign Het
Mms22l T A 4: 24,591,076 Y1016N probably damaging Het
Mrgprb5 A T 7: 48,168,330 V219E probably damaging Het
Nars2 G A 7: 97,002,829 S209N probably benign Het
Nckap5 T C 1: 126,026,710 T702A probably damaging Het
Olfr385 T C 11: 73,589,543 N65S possibly damaging Het
Paf1 A G 7: 28,398,832 probably benign Het
Prl3d1 A T 13: 27,098,710 R145* probably null Het
Rasl10b G A 11: 83,417,839 probably null Het
Rnf13 T A 3: 57,779,496 N103K probably damaging Het
Senp1 T C 15: 98,075,853 S170G probably benign Het
Slc46a2 A G 4: 59,914,620 L101P probably damaging Het
Tmem123 C T 9: 7,791,106 T136M probably damaging Het
Tpo T A 12: 30,103,110 H415L probably damaging Het
Vipr2 A G 12: 116,137,330 I255V probably benign Het
Zc3h11a A T 1: 133,633,803 V310E probably damaging Het
Zfp3 T A 11: 70,772,636 C474S probably damaging Het
Zfp707 T A 15: 75,974,616 C99S probably damaging Het
Zranb1 C T 7: 132,971,333 P410S probably damaging Het
Zswim8 G T 14: 20,710,748 R30L probably damaging Het
Other mutations in Ly6g
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01403:Ly6g APN 15 75158648 missense probably damaging 1.00
IGL02294:Ly6g APN 15 75158564 missense possibly damaging 0.87
R1450:Ly6g UTSW 15 75158633 missense probably benign 0.16
R4179:Ly6g UTSW 15 75155718 splice site probably null
R5746:Ly6g UTSW 15 75156747 missense possibly damaging 0.92
R6514:Ly6g UTSW 15 75156732 missense probably benign 0.00
R6777:Ly6g UTSW 15 75158582 missense probably benign 0.04
R6967:Ly6g UTSW 15 75158549 missense possibly damaging 0.81
R7574:Ly6g UTSW 15 75158564 missense probably benign 0.39
Predicted Primers PCR Primer
(F):5'- GGCAGTAATGTCCTTGCTCTGTCC -3'
(R):5'- ATCACATGACTGCACTGGCGAC -3'

Sequencing Primer
(F):5'- TGCTCTGTCCTAGAAGTCAAC -3'
(R):5'- TGACTGCACTGGCGACATAAG -3'
Posted On2014-03-17