Incidental Mutation 'R1389:Mfsd3'
ID162560
Institutional Source Beutler Lab
Gene Symbol Mfsd3
Ensembl Gene ENSMUSG00000019080
Gene Namemajor facilitator superfamily domain containing 3
Synonyms
MMRRC Submission 039451-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.072) question?
Stock #R1389 (G1)
Quality Score173
Status Not validated
Chromosome15
Chromosomal Location76701465-76704239 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 76702689 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 243 (H243R)
Ref Sequence ENSEMBL: ENSMUSP00000019224 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019224] [ENSMUST00000023203] [ENSMUST00000036852] [ENSMUST00000229140] [ENSMUST00000229679] [ENSMUST00000229734] [ENSMUST00000230544] [ENSMUST00000230724] [ENSMUST00000231028]
Predicted Effect probably benign
Transcript: ENSMUST00000019224
AA Change: H243R

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000019224
Gene: ENSMUSG00000019080
AA Change: H243R

DomainStartEndE-ValueType
Pfam:MFS_1 8 373 3e-16 PFAM
transmembrane domain 388 407 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000023203
SMART Domains Protein: ENSMUSP00000023203
Gene: ENSMUSG00000022546

DomainStartEndE-ValueType
Pfam:Aminotran_1_2 83 484 7.8e-35 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000036852
SMART Domains Protein: ENSMUSP00000044363
Gene: ENSMUSG00000033762

DomainStartEndE-ValueType
Pfam:Drc1-Sld2 4 132 2.8e-14 PFAM
low complexity region 169 187 N/A INTRINSIC
low complexity region 368 379 N/A INTRINSIC
ZnF_C2HC 394 410 5.67e-5 SMART
DEXDc 494 701 5.86e-28 SMART
HELICc 736 831 1.48e-24 SMART
Blast:DEXDc 902 1117 3e-46 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228987
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229018
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229098
Predicted Effect probably benign
Transcript: ENSMUST00000229140
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229340
Predicted Effect probably benign
Transcript: ENSMUST00000229679
Predicted Effect probably benign
Transcript: ENSMUST00000229734
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229856
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230283
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230468
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230482
Predicted Effect probably benign
Transcript: ENSMUST00000230544
Predicted Effect probably benign
Transcript: ENSMUST00000230724
Predicted Effect probably benign
Transcript: ENSMUST00000231028
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.7%
  • 20x: 90.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsl3 A C 1: 78,688,282 I142L probably benign Het
Adgra2 C T 8: 27,111,088 P252L probably damaging Het
Akap6 A G 12: 53,139,520 E1239G probably benign Het
Arhgef17 TGGAGGAGGAGGAGGAGG TGGAGGAGGAGGAGG 7: 100,931,037 probably benign Het
Btbd11 A G 10: 85,640,596 T914A possibly damaging Het
Calml4 A T 9: 62,871,266 D12V probably damaging Het
Car9 G T 4: 43,512,439 probably null Het
Ccar2 C A 14: 70,140,109 V699L possibly damaging Het
Ccdc27 T C 4: 154,041,769 M88V unknown Het
Ceacam15 T C 7: 16,672,063 R188G probably damaging Het
Dcaf8 G A 1: 172,174,052 R272H probably benign Het
Dchs1 A G 7: 105,755,571 V2588A probably benign Het
Dst G A 1: 34,211,232 R1749H probably damaging Het
Exog A G 9: 119,462,506 Q283R probably benign Het
Fmnl1 A T 11: 103,186,709 probably null Het
Gramd1c T C 16: 43,990,722 D213G probably damaging Het
Iqgap1 A G 7: 80,759,756 probably null Het
Itgae A G 11: 73,125,362 Y799C probably damaging Het
Kalrn T C 16: 33,988,803 I903V probably benign Het
Kcnh1 A G 1: 192,505,763 E844G probably benign Het
Khdc1a A T 1: 21,350,027 D3V probably damaging Het
Ly6g T C 15: 75,156,766 F25S probably benign Het
Mapk1ip1 G A 7: 138,836,727 probably benign Het
Mms22l T A 4: 24,591,076 Y1016N probably damaging Het
Mrgprb5 A T 7: 48,168,330 V219E probably damaging Het
Nars2 G A 7: 97,002,829 S209N probably benign Het
Nckap5 T C 1: 126,026,710 T702A probably damaging Het
Olfr385 T C 11: 73,589,543 N65S possibly damaging Het
Paf1 A G 7: 28,398,832 probably benign Het
Prl3d1 A T 13: 27,098,710 R145* probably null Het
Rasl10b G A 11: 83,417,839 probably null Het
Rnf13 T A 3: 57,779,496 N103K probably damaging Het
Senp1 T C 15: 98,075,853 S170G probably benign Het
Slc46a2 A G 4: 59,914,620 L101P probably damaging Het
Tmem123 C T 9: 7,791,106 T136M probably damaging Het
Tpo T A 12: 30,103,110 H415L probably damaging Het
Vipr2 A G 12: 116,137,330 I255V probably benign Het
Zc3h11a A T 1: 133,633,803 V310E probably damaging Het
Zfp3 T A 11: 70,772,636 C474S probably damaging Het
Zfp707 T A 15: 75,974,616 C99S probably damaging Het
Zranb1 C T 7: 132,971,333 P410S probably damaging Het
Zswim8 G T 14: 20,710,748 R30L probably damaging Het
Other mutations in Mfsd3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02965:Mfsd3 APN 15 76703152 missense probably benign 0.01
IGL03159:Mfsd3 APN 15 76702901 missense probably benign
R1232:Mfsd3 UTSW 15 76703182 missense probably damaging 1.00
R1535:Mfsd3 UTSW 15 76702779 missense probably damaging 1.00
R4159:Mfsd3 UTSW 15 76701745 missense probably damaging 1.00
R4993:Mfsd3 UTSW 15 76701982 missense probably damaging 1.00
R5307:Mfsd3 UTSW 15 76702171 nonsense probably null
R6902:Mfsd3 UTSW 15 76703149 missense probably damaging 1.00
R6946:Mfsd3 UTSW 15 76703149 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAGCCCAAACTCTATGTTGGTCCC -3'
(R):5'- TGCAGCACTGTCTTCAACAGCTTC -3'

Sequencing Primer
(F):5'- GACTGCCCTATGCTGGAATAC -3'
(R):5'- TGTCTTCAACAGCTTCAGTGG -3'
Posted On2014-03-17