Incidental Mutation 'R1391:Cnst'
ID162595
Institutional Source Beutler Lab
Gene Symbol Cnst
Ensembl Gene ENSMUSG00000038949
Gene Nameconsortin, connexin sorting protein
Synonyms
MMRRC Submission 039453-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.118) question?
Stock #R1391 (G1)
Quality Score180
Status Not validated
Chromosome1
Chromosomal Location179546370-179627478 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 179579486 bp
ZygosityHeterozygous
Amino Acid Change Proline to Threonine at position 33 (P33T)
Ref Sequence ENSEMBL: ENSMUSP00000048205 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040706]
Predicted Effect possibly damaging
Transcript: ENSMUST00000040706
AA Change: P33T

PolyPhen 2 Score 0.805 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000048205
Gene: ENSMUSG00000038949
AA Change: P33T

DomainStartEndE-ValueType
low complexity region 109 126 N/A INTRINSIC
low complexity region 142 150 N/A INTRINSIC
low complexity region 555 566 N/A INTRINSIC
Pfam:Consortin_C 598 709 3.4e-56 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144370
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153962
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.7%
  • 10x: 94.4%
  • 20x: 86.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Targeting of numerous transmembrane proteins to the cell surface is thought to depend on their recognition by cargo receptors that interact with the adaptor machinery for anterograde traffic at the distal end of the Golgi complex. Consortin (CNST) is an integral membrane protein that acts as a binding partner of connexins, the building blocks of gap junctions, and acts as a trans-Golgi network (TGN) receptor involved in connexin targeting to the plasma membrane and recycling from the cell surface (del Castillo et al., 2010 [PubMed 19864490]).[supplied by OMIM, Jun 2010]
Allele List at MGI
Other mutations in this stock
Total: 20 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Amer3 A T 1: 34,588,389 T570S probably benign Het
Ank3 A T 10: 69,534,280 K20I possibly damaging Het
Bmp10 G A 6: 87,433,758 E178K probably benign Het
Brca1 T A 11: 101,526,546 H254L possibly damaging Het
Cdon C T 9: 35,504,189 S1241L possibly damaging Het
Dnhd1 A G 7: 105,720,124 Y4318C probably damaging Het
Farp1 G A 14: 121,257,966 W611* probably null Het
Fst C T 13: 114,454,279 probably benign Het
Gapvd1 A G 2: 34,706,802 L714P probably damaging Het
Hectd4 T G 5: 121,353,695 L3732R possibly damaging Het
Lox A G 18: 52,528,819 Y171H probably damaging Het
Magi3 T A 3: 104,015,058 K1448* probably null Het
Med12l T A 3: 59,037,738 I128N probably benign Het
Pkd1l2 T C 8: 117,054,934 T791A possibly damaging Het
Prrt4 A G 6: 29,169,951 V834A possibly damaging Het
Ptprz1 A G 6: 23,001,729 S1273G probably benign Het
Slc13a4 A C 6: 35,271,662 F517V probably damaging Het
Treh T C 9: 44,685,305 V452A probably benign Het
Vmn2r83 T A 10: 79,479,097 M393K probably damaging Het
Zfp931 T C 2: 178,068,191 N134S probably benign Het
Other mutations in Cnst
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00917:Cnst APN 1 179624992 splice site probably benign
R0360:Cnst UTSW 1 179579535 missense probably benign 0.00
R1743:Cnst UTSW 1 179610392 missense probably benign 0.18
R1909:Cnst UTSW 1 179622791 missense probably damaging 1.00
R3856:Cnst UTSW 1 179579714 missense probably benign 0.02
R4565:Cnst UTSW 1 179604549 missense probably damaging 1.00
R5041:Cnst UTSW 1 179605028 missense probably damaging 0.99
R5072:Cnst UTSW 1 179622886 missense possibly damaging 0.61
R5087:Cnst UTSW 1 179622813 missense possibly damaging 0.82
R5294:Cnst UTSW 1 179610440 missense probably benign 0.03
R5349:Cnst UTSW 1 179622897 missense possibly damaging 0.58
R5394:Cnst UTSW 1 179601736 splice site probably benign
R6020:Cnst UTSW 1 179609875 missense probably benign
R6198:Cnst UTSW 1 179592865 missense probably damaging 1.00
R6669:Cnst UTSW 1 179605073 splice site probably null
R6767:Cnst UTSW 1 179609954 missense possibly damaging 0.92
R7007:Cnst UTSW 1 179610568 missense probably damaging 1.00
R7179:Cnst UTSW 1 179579382 start gained probably benign
R7356:Cnst UTSW 1 179606530 missense probably benign 0.01
R7730:Cnst UTSW 1 179625085 missense probably damaging 1.00
R7900:Cnst UTSW 1 179622888 missense probably damaging 1.00
R7983:Cnst UTSW 1 179622888 missense probably damaging 1.00
R8073:Cnst UTSW 1 179606437 missense probably benign 0.00
Z1088:Cnst UTSW 1 179579565 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TCCTAACTCCAGCGAAGTGGAACG -3'
(R):5'- TTTGGTCCTGTCCCAAGGAAGGTG -3'

Sequencing Primer
(F):5'- TGAAGTAGCCGTAACTAAGTCC -3'
(R):5'- GTCATCTTTGGGACCTTCGC -3'
Posted On2014-03-17