Incidental Mutation 'R1391:Bmp10'
ID162607
Institutional Source Beutler Lab
Gene Symbol Bmp10
Ensembl Gene ENSMUSG00000030046
Gene Namebone morphogenetic protein 10
Synonyms
MMRRC Submission 039453-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1391 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location87428994-87437677 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 87433758 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Lysine at position 178 (E178K)
Ref Sequence ENSEMBL: ENSMUSP00000032125 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032125]
Predicted Effect probably benign
Transcript: ENSMUST00000032125
AA Change: E178K

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000032125
Gene: ENSMUSG00000030046
AA Change: E178K

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:TGFb_propeptide 52 256 8.1e-24 PFAM
TGFB 320 420 6.7e-52 SMART
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.7%
  • 10x: 94.4%
  • 20x: 86.3%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a secreted ligand of the TGF-beta (transforming growth factor-beta) superfamily of proteins. Ligands of this family bind various TGF-beta receptors leading to recruitment and activation of SMAD family transcription factors that regulate gene expression. The encoded preproprotein is proteolytically processed to generate the mature protein, which binds to the activin receptor-like kinase 1 (ALK1) and plays important roles in cardiovascular development including cardiomyocyte proliferation and regulation of heart size, closure of the ductus arteriosus, angiogenesis and ventricular trabeculation. Homozygous knockout mice for this gene exhibit impaired heart development and embryonic lethality. [provided by RefSeq, Aug 2016]
PHENOTYPE: Homozygous null mice display decreased embryo size, cardiac dysgenesis, defects in early embryonic vascular development, enlarged pericardium, arteriovenous malformations, and embryonic lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 20 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Amer3 A T 1: 34,588,389 T570S probably benign Het
Ank3 A T 10: 69,534,280 K20I possibly damaging Het
Brca1 T A 11: 101,526,546 H254L possibly damaging Het
Cdon C T 9: 35,504,189 S1241L possibly damaging Het
Cnst C A 1: 179,579,486 P33T possibly damaging Het
Dnhd1 A G 7: 105,720,124 Y4318C probably damaging Het
Farp1 G A 14: 121,257,966 W611* probably null Het
Fst C T 13: 114,454,279 probably benign Het
Gapvd1 A G 2: 34,706,802 L714P probably damaging Het
Hectd4 T G 5: 121,353,695 L3732R possibly damaging Het
Lox A G 18: 52,528,819 Y171H probably damaging Het
Magi3 T A 3: 104,015,058 K1448* probably null Het
Med12l T A 3: 59,037,738 I128N probably benign Het
Pkd1l2 T C 8: 117,054,934 T791A possibly damaging Het
Prrt4 A G 6: 29,169,951 V834A possibly damaging Het
Ptprz1 A G 6: 23,001,729 S1273G probably benign Het
Slc13a4 A C 6: 35,271,662 F517V probably damaging Het
Treh T C 9: 44,685,305 V452A probably benign Het
Vmn2r83 T A 10: 79,479,097 M393K probably damaging Het
Zfp931 T C 2: 178,068,191 N134S probably benign Het
Other mutations in Bmp10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00916:Bmp10 APN 6 87429160 missense possibly damaging 0.87
IGL00946:Bmp10 APN 6 87434362 missense probably damaging 1.00
IGL01483:Bmp10 APN 6 87433951 missense probably damaging 1.00
IGL02132:Bmp10 APN 6 87434148 missense probably benign
R1472:Bmp10 UTSW 6 87433797 missense probably benign 0.34
R1938:Bmp10 UTSW 6 87433720 missense possibly damaging 0.77
R2114:Bmp10 UTSW 6 87434459 missense probably benign 0.10
R2158:Bmp10 UTSW 6 87434080 missense probably benign 0.21
R4922:Bmp10 UTSW 6 87433575 missense probably benign 0.00
R5042:Bmp10 UTSW 6 87434057 missense probably damaging 0.98
R6041:Bmp10 UTSW 6 87434320 missense probably damaging 1.00
R7000:Bmp10 UTSW 6 87434193 missense probably benign 0.02
R7593:Bmp10 UTSW 6 87433669 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACCAGTCACTTTTAATGGGCTCCG -3'
(R):5'- CCACCCAATCTCCTTGAAGTCGATG -3'

Sequencing Primer
(F):5'- GGAAATATCCTCTCCTCTTCAATGTG -3'
(R):5'- GAAAGCATCTGAGTCCAGGTCC -3'
Posted On2014-03-17