Mutagenetix > Incidental Mutation

Incidental Mutation 'R1396:Rasal2'

162622

Institutional Source

Beutler Lab

Gene Symbol

Rasal2

Ensembl Gene

ENSMUSG00000070565

Gene Name

RAS protein activator like 2

Synonyms

A330066M24Rik

MMRRC Submission

039458-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1396 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

157135182-157412595 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 157164666 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Histidine to Glutamine at position 552 (H552Q)

Ref Sequence

ENSEMBL: ENSMUSP00000114964 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000078308] [ENSMUST00000132699]

AlphaFold

E9PW37

Predicted Effect

probably damaging
Transcript: ENSMUST00000078308
AA Change: H570Q

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000077423
Gene: ENSMUSG00000070565
AA Change: H570Q

Domain	Start	End	E-Value	Type
low complexity region	36	47	N/A	INTRINSIC
PH	58	307	3.97e-8	SMART
C2	317	413	6.01e-10	SMART
RasGAP	423	767	4.56e-157	SMART
low complexity region	780	791	N/A	INTRINSIC
low complexity region	1063	1075	N/A	INTRINSIC
low complexity region	1084	1092	N/A	INTRINSIC
coiled coil region	1117	1236	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000132699
AA Change: H552Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000114964
Gene: ENSMUSG00000070565
AA Change: H552Q

Domain	Start	End	E-Value	Type
low complexity region	18	29	N/A	INTRINSIC
PH	40	289	1.7e-10	SMART
C2	299	395	4e-12	SMART
RasGAP	405	742	4.2e-153	SMART
low complexity region	755	766	N/A	INTRINSIC
low complexity region	1038	1050	N/A	INTRINSIC
low complexity region	1059	1067	N/A	INTRINSIC
coiled coil region	1092	1211	N/A	INTRINSIC

Coding Region Coverage

1x: 98.9%
3x: 98.0%
10x: 95.3%
20x: 89.4%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that contains the GAP-related domain (GRD), a characteristic domain of GTPase-activating proteins (GAPs). GAPs function as activators of Ras superfamily of small GTPases. The protein encoded by this gene is able to complement the defective RasGAP function in a yeast system. Two alternatively spliced transcript variants of this gene encoding distinct isoforms have been reported. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit reduced survival and decreased tumor latency. In other tumorigenic models, this allele promotes increase metastatic potential. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 57 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4921530L21Rik	A	G	14: 95,882,551	N248S	probably benign	Het
4930486L24Rik	G	A	13: 60,853,243	P160S	probably benign	Het
Adamts12	G	T	15: 11,311,472	D1272Y	probably benign	Het
Akr1c20	A	T	13: 4,507,727	V267D	probably damaging	Het
C1s1	A	G	6: 124,531,051	S660P	probably damaging	Het
Ccdc40	A	G	11: 119,231,803	T144A	possibly damaging	Het
Cdk20	T	C	13: 64,437,403	I167T	probably damaging	Het
Chd6	A	G	2: 160,983,103	L1212S	probably damaging	Het
Clock	G	C	5: 76,266,802	D15E	probably benign	Het
Clstn2	A	G	9: 97,461,393	V667A	probably benign	Het
Cr2	A	T	1: 195,169,253		probably null	Het
Cyp2e1	A	G	7: 140,773,079	D343G	probably damaging	Het
Dync1h1	G	A	12: 110,636,509	E2195K	probably benign	Het
Etf1	G	A	18: 34,908,167	T298I	possibly damaging	Het
Gm5431	T	C	11: 48,895,434		probably benign	Het
Gss	G	A	2: 155,567,721	T265I	probably damaging	Het
Heatr1	C	T	13: 12,406,046	S406L	possibly damaging	Het
Hgsnat	C	A	8: 25,957,335	M310I	possibly damaging	Het
Inpp5b	G	A	4: 124,789,080	R598H	probably damaging	Het
Ints2	G	T	11: 86,249,248	Q253K	probably damaging	Het
Kng1	A	G	16: 23,078,980	M377V	probably benign	Het
Krt72	C	T	15: 101,786,005		probably null	Het
Lemd2	G	C	17: 27,190,732	R482G	probably damaging	Het
Lrpprc	C	T	17: 84,726,303	D1049N	possibly damaging	Het
Lrrc49	A	T	9: 60,680,527	H117Q	probably damaging	Het
Mcm6	A	T	1: 128,351,476	F191Y	probably damaging	Het
Mecom	T	C	3: 29,979,800	T252A	possibly damaging	Het
Mgat4e	T	C	1: 134,541,533	T258A	probably benign	Het
Mpeg1	A	G	19: 12,462,804	N542S	probably damaging	Het
Nln	C	T	13: 104,061,753	V184I	probably benign	Het
Nova1	A	C	12: 46,816,893	F91L	unknown	Het
Polk	T	C	13: 96,484,208	I516V	probably benign	Het
Ppig	C	T	2: 69,749,018	P357S	unknown	Het
Ptpro	T	A	6: 137,443,594	V1007D	probably damaging	Het
Rnf41	G	A	10: 128,435,571	E117K	probably benign	Het
Sbk3	A	G	7: 4,967,453	Y306H	possibly damaging	Het
Senp1	A	G	15: 98,076,554	S126P	probably benign	Het
Sfr1	A	G	19: 47,733,690	K182E	probably benign	Het
Slc25a4	C	A	8: 46,209,288	R111L	probably damaging	Het
Slc9c1	A	T	16: 45,573,347	Y551F	probably benign	Het
Stard4	A	T	18: 33,206,210	N80K	probably damaging	Het
Tbk1	G	A	10: 121,571,916	T104M	probably damaging	Het
Tedc2	C	A	17: 24,216,318	E366*	probably null	Het
Tedc2	T	A	17: 24,216,317	E366V	probably damaging	Het
Tmem102	A	T	11: 69,804,370	W259R	probably damaging	Het
Tnk1	A	T	11: 69,853,136	C466S	probably benign	Het
Tspoap1	A	C	11: 87,766,120	Q307P	probably damaging	Het
Ugt2b35	A	G	5: 87,011,530	N528D	possibly damaging	Het
Usp6nl	A	G	2: 6,426,998		probably null	Het
Vmn1r203	C	T	13: 22,524,508	T153M	probably benign	Het
Vmn1r89	T	A	7: 13,220,011	S157T	probably damaging	Het
Vmn2r103	A	T	17: 19,792,968	Y117F	probably benign	Het
Vmn2r116	A	C	17: 23,386,141	M143L	probably benign	Het
Vmn2r62	A	T	7: 42,764,837	D727E	probably damaging	Het
Vps13c	A	G	9: 67,955,022	I2974V	probably benign	Het
Wrn	C	T	8: 33,268,819	G769D	probably damaging	Het
Zhx3	T	A	2: 160,781,020	H409L	possibly damaging	Het

Other mutations in Rasal2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00473:Rasal2	APN	1	157147817	missense	probably benign
IGL00484:Rasal2	APN	1	157174175	splice site	probably null
IGL00731:Rasal2	APN	1	157157764	missense	probably benign	0.01
IGL00900:Rasal2	APN	1	157411929	missense	possibly damaging	0.73
IGL01346:Rasal2	APN	1	157161216	missense	probably benign	0.19
IGL01635:Rasal2	APN	1	157163824	missense	probably damaging	1.00
IGL01759:Rasal2	APN	1	157175932	missense	probably benign	0.42
IGL01939:Rasal2	APN	1	157175910	missense	probably damaging	1.00
IGL01954:Rasal2	APN	1	157177699	missense	possibly damaging	0.83
IGL01954:Rasal2	APN	1	157176116	missense	probably damaging	0.99
IGL02005:Rasal2	APN	1	157156998	nonsense	probably null
IGL02056:Rasal2	APN	1	157299261	missense	probably damaging	0.99
IGL02444:Rasal2	APN	1	157299195	missense	probably benign	0.20
IGL02496:Rasal2	APN	1	157149879	missense	possibly damaging	0.69
IGL02832:Rasal2	APN	1	157157207	missense	probably damaging	1.00
IGL03351:Rasal2	APN	1	157192741	splice site	probably benign
R0456:Rasal2	UTSW	1	157149843	missense	probably damaging	1.00
R0537:Rasal2	UTSW	1	157147792	missense	possibly damaging	0.46
R0681:Rasal2	UTSW	1	157157180	missense	possibly damaging	0.70
R0682:Rasal2	UTSW	1	157179209	missense	probably damaging	1.00
R0683:Rasal2	UTSW	1	157179209	missense	probably damaging	1.00
R0787:Rasal2	UTSW	1	157158696	missense	probably damaging	1.00
R0789:Rasal2	UTSW	1	157157321	missense	probably damaging	1.00
R1109:Rasal2	UTSW	1	157177638	unclassified	probably benign
R1175:Rasal2	UTSW	1	157147648	missense	probably damaging	1.00
R1332:Rasal2	UTSW	1	157175821	missense	probably benign	0.00
R1535:Rasal2	UTSW	1	157230059	missense	probably benign	0.28
R1542:Rasal2	UTSW	1	157175851	missense	possibly damaging	0.84
R1703:Rasal2	UTSW	1	157157600	missense	probably damaging	1.00
R1735:Rasal2	UTSW	1	157174160	missense	probably damaging	1.00
R1762:Rasal2	UTSW	1	157299144	missense	possibly damaging	0.52
R2570:Rasal2	UTSW	1	157161300	missense	possibly damaging	0.85
R3148:Rasal2	UTSW	1	157243764	intron	probably benign
R3157:Rasal2	UTSW	1	157158655	splice site	probably benign
R4277:Rasal2	UTSW	1	157157126	missense	possibly damaging	0.46
R4459:Rasal2	UTSW	1	157175832	missense	possibly damaging	0.46
R4460:Rasal2	UTSW	1	157175832	missense	possibly damaging	0.46
R4563:Rasal2	UTSW	1	157175991	missense	probably damaging	1.00
R4672:Rasal2	UTSW	1	157243661	missense	probably benign	0.10
R4894:Rasal2	UTSW	1	157192804	missense	probably damaging	0.97
R5147:Rasal2	UTSW	1	157175694	missense	probably damaging	1.00
R5387:Rasal2	UTSW	1	157157765	missense	possibly damaging	0.81
R5421:Rasal2	UTSW	1	157299141	missense	probably benign	0.37
R5459:Rasal2	UTSW	1	157157661	missense	probably damaging	0.99
R5651:Rasal2	UTSW	1	157157381	missense	probably damaging	1.00
R5767:Rasal2	UTSW	1	157176162	missense	probably damaging	1.00
R5778:Rasal2	UTSW	1	157161290	missense	probably damaging	1.00
R6298:Rasal2	UTSW	1	157411862	missense	possibly damaging	0.85
R6332:Rasal2	UTSW	1	157299187	missense	probably damaging	1.00
R6571:Rasal2	UTSW	1	157161179	missense	possibly damaging	0.72
R7258:Rasal2	UTSW	1	157157700	missense	probably damaging	0.96
R7545:Rasal2	UTSW	1	157192769	missense	possibly damaging	0.93
R7558:Rasal2	UTSW	1	157175836	missense	probably damaging	0.99
R7894:Rasal2	UTSW	1	157243648	missense	probably benign	0.01
R8140:Rasal2	UTSW	1	157299235	missense	probably damaging	0.97
R8141:Rasal2	UTSW	1	157164670	missense	possibly damaging	0.89
R8151:Rasal2	UTSW	1	157243584	missense	probably damaging	0.96
R8218:Rasal2	UTSW	1	157157381	missense	probably damaging	0.99
R8517:Rasal2	UTSW	1	157146279	critical splice acceptor site	probably null
R9021:Rasal2	UTSW	1	157230944	missense	unknown
RF024:Rasal2	UTSW	1	157147790	missense	probably damaging	0.97
Z1177:Rasal2	UTSW	1	157175673	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AGCTCACCATAACATCCTTAAAGGCTG -3'
(R):5'- TCCGAGGAAAGAAAACTCAAGTGCTC -3'

Sequencing Primer
(F):5'- AGCCTGATTCAGAAGTCCTG -3'
(R):5'- AACTCAAGTGCTCAGTCATTTCG -3'

Posted On

2014-03-17