Mutagenetix > Incidental Mutation

Incidental Mutation 'R1396:Cr2'

162623

Institutional Source

Beutler Lab

Gene Symbol

Cr2

Ensembl Gene

ENSMUSG00000026616

Gene Name

complement receptor 2

Synonyms

C3DR, CD21, Cr-1, Cr1, CD35, Cr-2

MMRRC Submission

039458-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.140) question?

Stock #

R1396 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

195136811-195176716 bp(-) (GRCm38)

Type of Mutation

splice site (6 bp from exon)

DNA Base Change (assembly)

A to T at 195169253 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000147804 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000043104] [ENSMUST00000043104] [ENSMUST00000082321] [ENSMUST00000193801] [ENSMUST00000195120] [ENSMUST00000210219] [ENSMUST00000210219]

AlphaFold

no structure available at present

Predicted Effect

probably null
Transcript: ENSMUST00000043104

SMART Domains

Protein: ENSMUSP00000044261
Gene: ENSMUSG00000026616

Domain	Start	End	E-Value	Type
CCP	2	58	5.04e-7	SMART
CCP	63	120	3.58e-12	SMART
CCP	125	191	1.2e-13	SMART
CCP	197	252	2.73e-17	SMART
CCP	256	311	1.01e-15	SMART
Blast:CCP	316	347	2e-13	BLAST

Predicted Effect

probably null
Transcript: ENSMUST00000043104

SMART Domains

Protein: ENSMUSP00000044261
Gene: ENSMUSG00000026616

Domain	Start	End	E-Value	Type
CCP	2	58	5.04e-7	SMART
CCP	63	120	3.58e-12	SMART
CCP	125	191	1.2e-13	SMART
CCP	197	252	2.73e-17	SMART
CCP	256	311	1.01e-15	SMART
Blast:CCP	316	347	2e-13	BLAST

Predicted Effect

probably benign
Transcript: ENSMUST00000082321

SMART Domains

Protein: ENSMUSP00000080938
Gene: ENSMUSG00000026616

Domain	Start	End	E-Value	Type
CCP	23	82	1.01e-11	SMART
CCP	91	147	9.1e-14	SMART
CCP	155	211	1.9e-16	SMART
CCP	216	272	1.6e-9	SMART
CCP	277	343	1.01e-11	SMART
CCP	352	407	1.2e-13	SMART
CCP	411	467	2.34e-16	SMART
CCP	472	523	1.24e0	SMART
CCP	528	594	4.48e-13	SMART
CCP	603	658	1.95e-13	SMART
CCP	718	778	1.75e-15	SMART
CCP	787	842	2.06e-12	SMART
CCP	850	906	7.92e-14	SMART
CCP	911	967	1.29e-13	SMART
transmembrane domain	975	997	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000193801

SMART Domains

Protein: ENSMUSP00000141276
Gene: ENSMUSG00000026616

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000194149

Predicted Effect

probably benign
Transcript: ENSMUST00000195120

SMART Domains

Protein: ENSMUSP00000141538
Gene: ENSMUSG00000026616

Domain	Start	End	E-Value	Type
CCP	23	82	4.9e-14	SMART
CCP	91	147	4.5e-16	SMART
CCP	155	211	9.1e-19	SMART
CCP	216	272	8e-12	SMART
CCP	277	343	5e-14	SMART
CCP	352	407	5.9e-16	SMART
CCP	411	467	1.1e-18	SMART
CCP	472	523	6.1e-3	SMART
CCP	528	594	2.2e-15	SMART
CCP	603	658	9.4e-16	SMART
CCP	718	778	8.3e-18	SMART
CCP	787	842	1e-14	SMART
CCP	850	906	4e-16	SMART
CCP	911	967	6.2e-16	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000195347

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000195722

Predicted Effect

probably null
Transcript: ENSMUST00000210219

Predicted Effect

probably null
Transcript: ENSMUST00000210219

Coding Region Coverage

1x: 98.9%
3x: 98.0%
10x: 95.3%
20x: 89.4%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a membrane protein, which functions as a receptor for Epstein-Barr virus (EBV) binding on B and T lymphocytes. Genetic variations in this gene are associated with susceptibility to systemic lupus erythematosus type 9 (SLEB9). Alternatively spliced transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Sep 2009]
PHENOTYPE: Homozygotes for targeted null mutations exhibit impaired humoral immune responses to T cell-dependent antigens, with limited affinity maturation, and reduced memory B cell and germinal center formation. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 57 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4921530L21Rik	A	G	14: 95,882,551	N248S	probably benign	Het
4930486L24Rik	G	A	13: 60,853,243	P160S	probably benign	Het
Adamts12	G	T	15: 11,311,472	D1272Y	probably benign	Het
Akr1c20	A	T	13: 4,507,727	V267D	probably damaging	Het
C1s1	A	G	6: 124,531,051	S660P	probably damaging	Het
Ccdc40	A	G	11: 119,231,803	T144A	possibly damaging	Het
Cdk20	T	C	13: 64,437,403	I167T	probably damaging	Het
Chd6	A	G	2: 160,983,103	L1212S	probably damaging	Het
Clock	G	C	5: 76,266,802	D15E	probably benign	Het
Clstn2	A	G	9: 97,461,393	V667A	probably benign	Het
Cyp2e1	A	G	7: 140,773,079	D343G	probably damaging	Het
Dync1h1	G	A	12: 110,636,509	E2195K	probably benign	Het
Etf1	G	A	18: 34,908,167	T298I	possibly damaging	Het
Gm5431	T	C	11: 48,895,434		probably benign	Het
Gss	G	A	2: 155,567,721	T265I	probably damaging	Het
Heatr1	C	T	13: 12,406,046	S406L	possibly damaging	Het
Hgsnat	C	A	8: 25,957,335	M310I	possibly damaging	Het
Inpp5b	G	A	4: 124,789,080	R598H	probably damaging	Het
Ints2	G	T	11: 86,249,248	Q253K	probably damaging	Het
Kng1	A	G	16: 23,078,980	M377V	probably benign	Het
Krt72	C	T	15: 101,786,005		probably null	Het
Lemd2	G	C	17: 27,190,732	R482G	probably damaging	Het
Lrpprc	C	T	17: 84,726,303	D1049N	possibly damaging	Het
Lrrc49	A	T	9: 60,680,527	H117Q	probably damaging	Het
Mcm6	A	T	1: 128,351,476	F191Y	probably damaging	Het
Mecom	T	C	3: 29,979,800	T252A	possibly damaging	Het
Mgat4e	T	C	1: 134,541,533	T258A	probably benign	Het
Mpeg1	A	G	19: 12,462,804	N542S	probably damaging	Het
Nln	C	T	13: 104,061,753	V184I	probably benign	Het
Nova1	A	C	12: 46,816,893	F91L	unknown	Het
Polk	T	C	13: 96,484,208	I516V	probably benign	Het
Ppig	C	T	2: 69,749,018	P357S	unknown	Het
Ptpro	T	A	6: 137,443,594	V1007D	probably damaging	Het
Rasal2	A	T	1: 157,164,666	H552Q	probably damaging	Het
Rnf41	G	A	10: 128,435,571	E117K	probably benign	Het
Sbk3	A	G	7: 4,967,453	Y306H	possibly damaging	Het
Senp1	A	G	15: 98,076,554	S126P	probably benign	Het
Sfr1	A	G	19: 47,733,690	K182E	probably benign	Het
Slc25a4	C	A	8: 46,209,288	R111L	probably damaging	Het
Slc9c1	A	T	16: 45,573,347	Y551F	probably benign	Het
Stard4	A	T	18: 33,206,210	N80K	probably damaging	Het
Tbk1	G	A	10: 121,571,916	T104M	probably damaging	Het
Tedc2	C	A	17: 24,216,318	E366*	probably null	Het
Tedc2	T	A	17: 24,216,317	E366V	probably damaging	Het
Tmem102	A	T	11: 69,804,370	W259R	probably damaging	Het
Tnk1	A	T	11: 69,853,136	C466S	probably benign	Het
Tspoap1	A	C	11: 87,766,120	Q307P	probably damaging	Het
Ugt2b35	A	G	5: 87,011,530	N528D	possibly damaging	Het
Usp6nl	A	G	2: 6,426,998		probably null	Het
Vmn1r203	C	T	13: 22,524,508	T153M	probably benign	Het
Vmn1r89	T	A	7: 13,220,011	S157T	probably damaging	Het
Vmn2r103	A	T	17: 19,792,968	Y117F	probably benign	Het
Vmn2r116	A	C	17: 23,386,141	M143L	probably benign	Het
Vmn2r62	A	T	7: 42,764,837	D727E	probably damaging	Het
Vps13c	A	G	9: 67,955,022	I2974V	probably benign	Het
Wrn	C	T	8: 33,268,819	G769D	probably damaging	Het
Zhx3	T	A	2: 160,781,020	H409L	possibly damaging	Het

Other mutations in Cr2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00587:Cr2	APN	1	195154251	missense	possibly damaging	0.76
IGL01326:Cr2	APN	1	195141221	missense	probably null	1.00
IGL01358:Cr2	APN	1	195159820	missense	probably damaging	1.00
IGL01410:Cr2	APN	1	195163234	missense	possibly damaging	0.49
IGL01468:Cr2	APN	1	195168535	missense	probably damaging	1.00
IGL01608:Cr2	APN	1	195155220	missense	possibly damaging	0.50
IGL01810:Cr2	APN	1	195159595	missense	possibly damaging	0.49
IGL01843:Cr2	APN	1	195150914	splice site	probably benign
IGL02332:Cr2	APN	1	195160322	missense	probably benign	0.19
IGL02934:Cr2	APN	1	195154325	splice site	probably benign
IGL02938:Cr2	APN	1	195166388	missense	probably damaging	1.00
IGL03149:Cr2	APN	1	195166366	missense	probably damaging	1.00
IGL03327:Cr2	APN	1	195169759	missense	probably damaging	1.00
IGL03346:Cr2	APN	1	195169759	missense	probably damaging	1.00
Pillar	UTSW	1	195155888	nonsense	probably null
PIT4354001:Cr2	UTSW	1	195166309	missense	probably damaging	1.00
PIT4418001:Cr2	UTSW	1	195157452	missense	probably benign	0.08
R0128:Cr2	UTSW	1	195166231	missense	probably damaging	0.99
R0130:Cr2	UTSW	1	195166231	missense	probably damaging	0.99
R0380:Cr2	UTSW	1	195157407	missense	probably damaging	1.00
R0538:Cr2	UTSW	1	195160359	splice site	probably benign
R0605:Cr2	UTSW	1	195163596	splice site	probably benign
R0626:Cr2	UTSW	1	195171111	missense	possibly damaging	0.95
R1135:Cr2	UTSW	1	195157190	missense	probably damaging	1.00
R1422:Cr2	UTSW	1	195171125	missense	probably benign	0.01
R1467:Cr2	UTSW	1	195157509	missense	probably damaging	1.00
R1467:Cr2	UTSW	1	195157509	missense	probably damaging	1.00
R1511:Cr2	UTSW	1	195155272	missense	possibly damaging	0.92
R1572:Cr2	UTSW	1	195163314	missense	probably damaging	1.00
R1714:Cr2	UTSW	1	195151686	missense	possibly damaging	0.46
R1748:Cr2	UTSW	1	195155905	nonsense	probably null
R1761:Cr2	UTSW	1	195155123	critical splice donor site	probably null
R1824:Cr2	UTSW	1	195157316	missense	probably damaging	1.00
R1893:Cr2	UTSW	1	195155187	missense	probably benign	0.03
R1990:Cr2	UTSW	1	195154150	missense	possibly damaging	0.63
R1991:Cr2	UTSW	1	195154150	missense	possibly damaging	0.63
R1992:Cr2	UTSW	1	195154150	missense	possibly damaging	0.63
R2191:Cr2	UTSW	1	195163381	missense	possibly damaging	0.94
R2276:Cr2	UTSW	1	195157368	missense	possibly damaging	0.94
R2277:Cr2	UTSW	1	195157368	missense	possibly damaging	0.94
R3548:Cr2	UTSW	1	195155888	nonsense	probably null
R3743:Cr2	UTSW	1	195149966	splice site	probably benign
R3941:Cr2	UTSW	1	195165814	missense	probably damaging	0.97
R3963:Cr2	UTSW	1	195159739	missense	probably damaging	1.00
R4211:Cr2	UTSW	1	195156328	missense	probably damaging	0.96
R4484:Cr2	UTSW	1	195154174	missense	probably damaging	1.00
R4546:Cr2	UTSW	1	195171041	missense	possibly damaging	0.94
R4791:Cr2	UTSW	1	195155935	missense	probably damaging	1.00
R4801:Cr2	UTSW	1	195163311	missense	probably damaging	1.00
R4802:Cr2	UTSW	1	195163311	missense	probably damaging	1.00
R4874:Cr2	UTSW	1	195176570	missense	possibly damaging	0.82
R4885:Cr2	UTSW	1	195158731	missense	possibly damaging	0.92
R4889:Cr2	UTSW	1	195176585	missense	possibly damaging	0.70
R5154:Cr2	UTSW	1	195159446	missense	probably damaging	1.00
R5574:Cr2	UTSW	1	195141236	missense	probably damaging	1.00
R5594:Cr2	UTSW	1	195157190	missense	probably damaging	1.00
R5645:Cr2	UTSW	1	195154273	missense	probably damaging	1.00
R5700:Cr2	UTSW	1	195159757	missense	probably damaging	0.96
R5929:Cr2	UTSW	1	195171111	missense	possibly damaging	0.91
R6237:Cr2	UTSW	1	195157502	missense	probably damaging	1.00
R6299:Cr2	UTSW	1	195168646	missense	probably damaging	1.00
R6368:Cr2	UTSW	1	195168472	missense	probably damaging	1.00
R6406:Cr2	UTSW	1	195169771	missense	probably damaging	1.00
R6618:Cr2	UTSW	1	195157379	missense	probably damaging	0.98
R6684:Cr2	UTSW	1	195171021	nonsense	probably null
R6720:Cr2	UTSW	1	195155200	missense	probably damaging	0.97
R6866:Cr2	UTSW	1	195151691	missense	probably damaging	1.00
R6915:Cr2	UTSW	1	195171146	missense	probably benign	0.06
R7057:Cr2	UTSW	1	195151610	missense	possibly damaging	0.83
R7117:Cr2	UTSW	1	195160601	missense	possibly damaging	0.79
R7200:Cr2	UTSW	1	195163249	missense	probably damaging	1.00
R7209:Cr2	UTSW	1	195168724	missense	probably damaging	1.00
R7350:Cr2	UTSW	1	195155286	missense	probably benign	0.21
R7414:Cr2	UTSW	1	195150036	missense	probably benign
R7453:Cr2	UTSW	1	195165257	splice site	probably null
R7479:Cr2	UTSW	1	195158410	critical splice donor site	probably null
R7480:Cr2	UTSW	1	195154176	missense	probably damaging	1.00
R7570:Cr2	UTSW	1	195169340	nonsense	probably null
R7666:Cr2	UTSW	1	195154225	missense	probably damaging	1.00
R7921:Cr2	UTSW	1	195151667	missense	possibly damaging	0.94
R7923:Cr2	UTSW	1	195168687	missense	probably benign	0.03
R8396:Cr2	UTSW	1	195158068	missense	probably damaging	1.00
R8503:Cr2	UTSW	1	195163542	missense	probably benign
R8517:Cr2	UTSW	1	195155899	missense	probably benign	0.03
R8773:Cr2	UTSW	1	195158605	missense	probably damaging	1.00
R8849:Cr2	UTSW	1	195157239	missense	probably damaging	1.00
R8896:Cr2	UTSW	1	195169273	missense	possibly damaging	0.58
R8938:Cr2	UTSW	1	195171116	missense	probably damaging	0.99
R9027:Cr2	UTSW	1	195151721	missense	probably benign	0.08
R9045:Cr2	UTSW	1	195155372	missense	possibly damaging	0.61
R9116:Cr2	UTSW	1	195158669	nonsense	probably null
R9137:Cr2	UTSW	1	195168332	critical splice donor site	probably null
R9476:Cr2	UTSW	1	195158108	missense	probably damaging	0.97
R9497:Cr2	UTSW	1	195168435	missense	probably damaging	0.99
R9510:Cr2	UTSW	1	195158108	missense	probably damaging	0.97
R9752:Cr2	UTSW	1	195141267	missense	probably benign	0.37
R9799:Cr2	UTSW	1	195160680	missense	probably benign	0.02
X0028:Cr2	UTSW	1	195149982	missense	probably benign	0.09
X0066:Cr2	UTSW	1	195166321	missense	probably damaging	0.99
Z1176:Cr2	UTSW	1	195154153	missense	probably benign	0.23

Predicted Primers

PCR Primer
(F):5'- GAGATTCTGGCACTATAGGCTTCTTGG -3'
(R):5'- CTCTTTGACTTGCTTCAGAAATGGCAC -3'

Sequencing Primer
(F):5'- CACTATAGGCTTCTTGGGGTGAAC -3'
(R):5'- GCTTCAGAAATGGCACTTCAGTC -3'

Posted On

2014-03-17