Incidental Mutation 'R1396:Usp6nl'
ID162624
Institutional Source Beutler Lab
Gene Symbol Usp6nl
Ensembl Gene ENSMUSG00000039046
Gene NameUSP6 N-terminal like
SynonymsTRE2NL
MMRRC Submission 039458-MU
Accession Numbers

Genbank: NM_181399, NM_001080548; MGI: 2138893

Is this an essential gene? Probably non essential (E-score: 0.112) question?
Stock #R1396 (G1)
Quality Score185
Status Not validated
Chromosome2
Chromosomal Location6322667-6446390 bp(+) (GRCm38)
Type of Mutationsplice site (9 bp from exon)
DNA Base Change (assembly) A to G at 6426998 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000110587 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042503] [ENSMUST00000114937]
Predicted Effect probably null
Transcript: ENSMUST00000042503
SMART Domains Protein: ENSMUSP00000043178
Gene: ENSMUSG00000039046

DomainStartEndE-ValueType
TBC 120 338 2.14e-78 SMART
low complexity region 486 499 N/A INTRINSIC
low complexity region 576 591 N/A INTRINSIC
low complexity region 594 614 N/A INTRINSIC
low complexity region 811 825 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000114937
SMART Domains Protein: ENSMUSP00000110587
Gene: ENSMUSG00000039046

DomainStartEndE-ValueType
TBC 97 315 2.14e-78 SMART
low complexity region 463 476 N/A INTRINSIC
low complexity region 553 568 N/A INTRINSIC
low complexity region 571 591 N/A INTRINSIC
low complexity region 788 802 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126659
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150515
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.3%
  • 20x: 89.4%
Validation Efficiency
Allele List at MGI

All alleles(32) : Gene trapped(32)

Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921530L21Rik A G 14: 95,882,551 N248S probably benign Het
4930486L24Rik G A 13: 60,853,243 P160S probably benign Het
Adamts12 G T 15: 11,311,472 D1272Y probably benign Het
Akr1c20 A T 13: 4,507,727 V267D probably damaging Het
C1s1 A G 6: 124,531,051 S660P probably damaging Het
Ccdc40 A G 11: 119,231,803 T144A possibly damaging Het
Cdk20 T C 13: 64,437,403 I167T probably damaging Het
Chd6 A G 2: 160,983,103 L1212S probably damaging Het
Clock G C 5: 76,266,802 D15E probably benign Het
Clstn2 A G 9: 97,461,393 V667A probably benign Het
Cr2 A T 1: 195,169,253 probably null Het
Cyp2e1 A G 7: 140,773,079 D343G probably damaging Het
Dync1h1 G A 12: 110,636,509 E2195K probably benign Het
Etf1 G A 18: 34,908,167 T298I possibly damaging Het
Gm5431 T C 11: 48,895,434 probably benign Het
Gss G A 2: 155,567,721 T265I probably damaging Het
Heatr1 C T 13: 12,406,046 S406L possibly damaging Het
Hgsnat C A 8: 25,957,335 M310I possibly damaging Het
Inpp5b G A 4: 124,789,080 R598H probably damaging Het
Ints2 G T 11: 86,249,248 Q253K probably damaging Het
Kng1 A G 16: 23,078,980 M377V probably benign Het
Krt72 C T 15: 101,786,005 probably null Het
Lemd2 G C 17: 27,190,732 R482G probably damaging Het
Lrpprc C T 17: 84,726,303 D1049N possibly damaging Het
Lrrc49 A T 9: 60,680,527 H117Q probably damaging Het
Mcm6 A T 1: 128,351,476 F191Y probably damaging Het
Mecom T C 3: 29,979,800 T252A possibly damaging Het
Mgat4e T C 1: 134,541,533 T258A probably benign Het
Mpeg1 A G 19: 12,462,804 N542S probably damaging Het
Nln C T 13: 104,061,753 V184I probably benign Het
Nova1 A C 12: 46,816,893 F91L unknown Het
Polk T C 13: 96,484,208 I516V probably benign Het
Ppig C T 2: 69,749,018 P357S unknown Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Rasal2 A T 1: 157,164,666 H552Q probably damaging Het
Rnf41 G A 10: 128,435,571 E117K probably benign Het
Sbk3 A G 7: 4,967,453 Y306H possibly damaging Het
Senp1 A G 15: 98,076,554 S126P probably benign Het
Sfr1 A G 19: 47,733,690 K182E probably benign Het
Slc25a4 C A 8: 46,209,288 R111L probably damaging Het
Slc9c1 A T 16: 45,573,347 Y551F probably benign Het
Stard4 A T 18: 33,206,210 N80K probably damaging Het
Tbk1 G A 10: 121,571,916 T104M probably damaging Het
Tedc2 T A 17: 24,216,317 E366V probably damaging Het
Tedc2 C A 17: 24,216,318 E366* probably null Het
Tmem102 A T 11: 69,804,370 W259R probably damaging Het
Tnk1 A T 11: 69,853,136 C466S probably benign Het
Tspoap1 A C 11: 87,766,120 Q307P probably damaging Het
Ugt2b35 A G 5: 87,011,530 N528D possibly damaging Het
Vmn1r203 C T 13: 22,524,508 T153M probably benign Het
Vmn1r89 T A 7: 13,220,011 S157T probably damaging Het
Vmn2r103 A T 17: 19,792,968 Y117F probably benign Het
Vmn2r116 A C 17: 23,386,141 M143L probably benign Het
Vmn2r62 A T 7: 42,764,837 D727E probably damaging Het
Vps13c A G 9: 67,955,022 I2974V probably benign Het
Wrn C T 8: 33,268,819 G769D probably damaging Het
Zhx3 T A 2: 160,781,020 H409L possibly damaging Het
Other mutations in Usp6nl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01021:Usp6nl APN 2 6424387 missense probably damaging 1.00
IGL01603:Usp6nl APN 2 6423435 missense probably damaging 1.00
IGL01690:Usp6nl APN 2 6441068 missense probably benign 0.01
IGL01778:Usp6nl APN 2 6427570 missense possibly damaging 0.78
IGL02799:Usp6nl APN 2 6427549 splice site probably benign
3-1:Usp6nl UTSW 2 6409017 splice site probably benign
R0060:Usp6nl UTSW 2 6440890 missense probably benign 0.17
R0544:Usp6nl UTSW 2 6421009 missense probably damaging 0.98
R0550:Usp6nl UTSW 2 6400323 splice site probably benign
R0701:Usp6nl UTSW 2 6415018 missense possibly damaging 0.75
R1967:Usp6nl UTSW 2 6441519 missense probably benign 0.01
R2120:Usp6nl UTSW 2 6440937 missense probably damaging 1.00
R2215:Usp6nl UTSW 2 6424339 missense probably damaging 1.00
R2366:Usp6nl UTSW 2 6440959 missense probably benign 0.00
R3737:Usp6nl UTSW 2 6440917 missense probably damaging 0.99
R4178:Usp6nl UTSW 2 6440976 missense probably benign 0.11
R4656:Usp6nl UTSW 2 6441162 missense probably damaging 1.00
R4970:Usp6nl UTSW 2 6420903 missense probably benign 0.05
R5112:Usp6nl UTSW 2 6420903 missense probably benign 0.05
R5621:Usp6nl UTSW 2 6440432 missense probably benign 0.40
R5642:Usp6nl UTSW 2 6430464 missense probably damaging 0.97
R5999:Usp6nl UTSW 2 6441339 missense probably damaging 1.00
R6931:Usp6nl UTSW 2 6430458 missense possibly damaging 0.55
R7188:Usp6nl UTSW 2 6440519 missense probably benign 0.03
R7696:Usp6nl UTSW 2 6424323 missense probably damaging 1.00
R8223:Usp6nl UTSW 2 6430516 missense probably damaging 1.00
R8321:Usp6nl UTSW 2 6391089 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- TTCGAGGGACACCATTTCCATGATG -3'
(R):5'- GTCACAGAGCCTTTTCAAGGCAAAC -3'

Sequencing Primer
(F):5'- CTTGGGATGCTATTTTCATAGCTAC -3'
(R):5'- CATAGTGAACTGTCTGATTGCAC -3'
Posted On2014-03-17