Incidental Mutation 'R1396:Clock'
ID162638
Institutional Source Beutler Lab
Gene Symbol Clock
Ensembl Gene ENSMUSG00000029238
Gene Namecircadian locomotor output cycles kaput
Synonyms5330400M04Rik, bHLHe8, KAT13D
MMRRC Submission 039458-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.831) question?
Stock #R1396 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location76209868-76304792 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to C at 76266802 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 15 (D15E)
Ref Sequence ENSEMBL: ENSMUSP00000143939 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075159] [ENSMUST00000202122] [ENSMUST00000202651]
Predicted Effect probably benign
Transcript: ENSMUST00000075159
AA Change: D15E

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000074656
Gene: ENSMUSG00000029238
AA Change: D15E

DomainStartEndE-ValueType
HLH 40 90 7.77e-12 SMART
PAS 109 175 1.88e-6 SMART
PAS 264 330 3.65e-4 SMART
PAC 336 379 7.63e-7 SMART
low complexity region 426 446 N/A INTRINSIC
low complexity region 478 493 N/A INTRINSIC
coiled coil region 523 559 N/A INTRINSIC
low complexity region 619 634 N/A INTRINSIC
low complexity region 640 657 N/A INTRINSIC
low complexity region 738 796 N/A INTRINSIC
low complexity region 818 837 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200957
Predicted Effect probably benign
Transcript: ENSMUST00000202122
AA Change: D15E

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000144022
Gene: ENSMUSG00000029238
AA Change: D15E

DomainStartEndE-ValueType
TFS2N 34 106 4.1e-3 SMART
HLH 40 90 3.4e-14 SMART
PAS 109 175 9.6e-9 SMART
PAS 264 330 1.8e-6 SMART
PAC 336 379 3.9e-9 SMART
low complexity region 426 446 N/A INTRINSIC
low complexity region 478 493 N/A INTRINSIC
coiled coil region 523 559 N/A INTRINSIC
low complexity region 619 633 N/A INTRINSIC
low complexity region 639 656 N/A INTRINSIC
low complexity region 737 795 N/A INTRINSIC
low complexity region 817 836 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000202651
AA Change: D15E

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000143939
Gene: ENSMUSG00000029238
AA Change: D15E

DomainStartEndE-ValueType
HLH 40 90 7.77e-12 SMART
PAS 109 175 1.88e-6 SMART
PAS 264 330 3.65e-4 SMART
PAC 336 379 7.63e-7 SMART
low complexity region 426 446 N/A INTRINSIC
low complexity region 478 493 N/A INTRINSIC
coiled coil region 523 559 N/A INTRINSIC
low complexity region 619 634 N/A INTRINSIC
low complexity region 640 657 N/A INTRINSIC
low complexity region 738 796 N/A INTRINSIC
low complexity region 818 837 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202857
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.3%
  • 20x: 89.4%
Validation Efficiency
MGI Phenotype FUNCTION: The protein encoded by this gene plays a central role in the regulation of circadian rhythms. The protein encodes a transcription factor of the basic helix-loop-helix (bHLH) family and contains DNA binding histone acetyltransferase activity. The encoded protein forms a heterodimer with Arntl (Bmal1) that binds E-box enhancer elements upstream of Period (Per1, Per2, Per3) and Cryptochrome (Cry1, Cry2) genes and activates transcription of these genes. Per and Cry proteins heterodimerize and repress their own transcription by interacting in a feedback loop with Clock/Arntl complexes. Polymorphisms in this gene may be associated with behavioral changes, obesity, and metabolic syndrome. Two transcripts encoding the same protein have been found for this gene. [provided by RefSeq, Jan 2014]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit abnormal circadian phase. Mice homozygous for a spontaneous mutation exhibit abnormal circadian rhythm, reproduction, behavior, hair cycle, macronutrient absorption, and metabolism. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921530L21Rik A G 14: 95,882,551 N248S probably benign Het
4930486L24Rik G A 13: 60,853,243 P160S probably benign Het
Adamts12 G T 15: 11,311,472 D1272Y probably benign Het
Akr1c20 A T 13: 4,507,727 V267D probably damaging Het
C1s1 A G 6: 124,531,051 S660P probably damaging Het
Ccdc40 A G 11: 119,231,803 T144A possibly damaging Het
Cdk20 T C 13: 64,437,403 I167T probably damaging Het
Chd6 A G 2: 160,983,103 L1212S probably damaging Het
Clstn2 A G 9: 97,461,393 V667A probably benign Het
Cr2 A T 1: 195,169,253 probably null Het
Cyp2e1 A G 7: 140,773,079 D343G probably damaging Het
Dync1h1 G A 12: 110,636,509 E2195K probably benign Het
Etf1 G A 18: 34,908,167 T298I possibly damaging Het
Gm5431 T C 11: 48,895,434 probably benign Het
Gss G A 2: 155,567,721 T265I probably damaging Het
Heatr1 C T 13: 12,406,046 S406L possibly damaging Het
Hgsnat C A 8: 25,957,335 M310I possibly damaging Het
Inpp5b G A 4: 124,789,080 R598H probably damaging Het
Ints2 G T 11: 86,249,248 Q253K probably damaging Het
Kng1 A G 16: 23,078,980 M377V probably benign Het
Krt72 C T 15: 101,786,005 probably null Het
Lemd2 G C 17: 27,190,732 R482G probably damaging Het
Lrpprc C T 17: 84,726,303 D1049N possibly damaging Het
Lrrc49 A T 9: 60,680,527 H117Q probably damaging Het
Mcm6 A T 1: 128,351,476 F191Y probably damaging Het
Mecom T C 3: 29,979,800 T252A possibly damaging Het
Mgat4e T C 1: 134,541,533 T258A probably benign Het
Mpeg1 A G 19: 12,462,804 N542S probably damaging Het
Nln C T 13: 104,061,753 V184I probably benign Het
Nova1 A C 12: 46,816,893 F91L unknown Het
Polk T C 13: 96,484,208 I516V probably benign Het
Ppig C T 2: 69,749,018 P357S unknown Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Rasal2 A T 1: 157,164,666 H552Q probably damaging Het
Rnf41 G A 10: 128,435,571 E117K probably benign Het
Sbk3 A G 7: 4,967,453 Y306H possibly damaging Het
Senp1 A G 15: 98,076,554 S126P probably benign Het
Sfr1 A G 19: 47,733,690 K182E probably benign Het
Slc25a4 C A 8: 46,209,288 R111L probably damaging Het
Slc9c1 A T 16: 45,573,347 Y551F probably benign Het
Stard4 A T 18: 33,206,210 N80K probably damaging Het
Tbk1 G A 10: 121,571,916 T104M probably damaging Het
Tedc2 T A 17: 24,216,317 E366V probably damaging Het
Tedc2 C A 17: 24,216,318 E366* probably null Het
Tmem102 A T 11: 69,804,370 W259R probably damaging Het
Tnk1 A T 11: 69,853,136 C466S probably benign Het
Tspoap1 A C 11: 87,766,120 Q307P probably damaging Het
Ugt2b35 A G 5: 87,011,530 N528D possibly damaging Het
Usp6nl A G 2: 6,426,998 probably null Het
Vmn1r203 C T 13: 22,524,508 T153M probably benign Het
Vmn1r89 T A 7: 13,220,011 S157T probably damaging Het
Vmn2r103 A T 17: 19,792,968 Y117F probably benign Het
Vmn2r116 A C 17: 23,386,141 M143L probably benign Het
Vmn2r62 A T 7: 42,764,837 D727E probably damaging Het
Vps13c A G 9: 67,955,022 I2974V probably benign Het
Wrn C T 8: 33,268,819 G769D probably damaging Het
Zhx3 T A 2: 160,781,020 H409L possibly damaging Het
Other mutations in Clock
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00598:Clock APN 5 76229464 missense probably benign 0.17
IGL00725:Clock APN 5 76254413 nonsense probably null
IGL01304:Clock APN 5 76266355 critical splice donor site probably null
IGL01369:Clock APN 5 76237086 missense probably benign 0.30
IGL01542:Clock APN 5 76231475 missense possibly damaging 0.82
IGL02541:Clock APN 5 76262672 splice site probably null
IGL02602:Clock APN 5 76254426 missense probably null 1.00
IGL02602:Clock APN 5 76254427 missense probably damaging 1.00
IGL03186:Clock APN 5 76243082 missense probably damaging 0.98
IGL03309:Clock APN 5 76231394 critical splice donor site probably null
R6760_Clock_188 UTSW 5 76226976 missense unknown
uhr UTSW 5 76229554 nonsense probably null
R0304:Clock UTSW 5 76226985 missense unknown
R0593:Clock UTSW 5 76265836 missense probably benign 0.25
R0654:Clock UTSW 5 76227129 missense possibly damaging 0.95
R0684:Clock UTSW 5 76245518 missense probably damaging 0.96
R0707:Clock UTSW 5 76227129 missense possibly damaging 0.95
R0751:Clock UTSW 5 76229361 missense possibly damaging 0.75
R0865:Clock UTSW 5 76266424 splice site probably benign
R0920:Clock UTSW 5 76230320 missense possibly damaging 0.80
R1450:Clock UTSW 5 76262731 nonsense probably null
R1487:Clock UTSW 5 76266354 splice site probably null
R1574:Clock UTSW 5 76242832 missense probably damaging 1.00
R1574:Clock UTSW 5 76242832 missense probably damaging 1.00
R1858:Clock UTSW 5 76240909 missense possibly damaging 0.92
R1872:Clock UTSW 5 76248462 missense possibly damaging 0.67
R1905:Clock UTSW 5 76266888 splice site probably benign
R1937:Clock UTSW 5 76229493 missense probably damaging 0.99
R2411:Clock UTSW 5 76231513 missense probably benign 0.08
R2887:Clock UTSW 5 76245273 missense probably damaging 0.99
R3410:Clock UTSW 5 76229554 nonsense probably null
R4514:Clock UTSW 5 76230199 missense probably benign 0.00
R4598:Clock UTSW 5 76235810 missense probably benign 0.00
R4599:Clock UTSW 5 76235810 missense probably benign 0.00
R4795:Clock UTSW 5 76265916 missense probably damaging 1.00
R4796:Clock UTSW 5 76265916 missense probably damaging 1.00
R4973:Clock UTSW 5 76254411 missense possibly damaging 0.62
R5204:Clock UTSW 5 76243170 splice site probably null
R5271:Clock UTSW 5 76241954 missense probably damaging 1.00
R5547:Clock UTSW 5 76230338 missense probably benign 0.02
R5630:Clock UTSW 5 76230338 missense probably benign 0.02
R5631:Clock UTSW 5 76230338 missense probably benign 0.02
R5632:Clock UTSW 5 76230338 missense probably benign 0.02
R5787:Clock UTSW 5 76237051 missense probably damaging 1.00
R6274:Clock UTSW 5 76237153 missense probably benign 0.45
R6578:Clock UTSW 5 76216709 missense unknown
R6622:Clock UTSW 5 76241954 missense probably damaging 1.00
R6760:Clock UTSW 5 76226976 missense unknown
R6793:Clock UTSW 5 76237120 frame shift probably null
R7406:Clock UTSW 5 76266845 start codon destroyed probably null 0.26
R7414:Clock UTSW 5 76262764 missense probably benign 0.00
R7560:Clock UTSW 5 76242891 splice site probably null
R7593:Clock UTSW 5 76236298 missense possibly damaging 0.80
R7640:Clock UTSW 5 76248378 missense possibly damaging 0.71
R7708:Clock UTSW 5 76266409 missense probably benign 0.00
R7713:Clock UTSW 5 76245420 critical splice donor site probably null
R7807:Clock UTSW 5 76243135 missense probably benign 0.01
R8171:Clock UTSW 5 76266414 missense possibly damaging 0.94
R8190:Clock UTSW 5 76227204 missense probably damaging 0.98
R8225:Clock UTSW 5 76241912 missense probably damaging 0.99
R8309:Clock UTSW 5 76254422 missense probably benign 0.07
Predicted Primers PCR Primer
(F):5'- TTCCACACATGAACTCTGAAGGCAG -3'
(R):5'- GGTGATAACCACTGGGCAGTATAGC -3'

Sequencing Primer
(F):5'- CTCTGAAGGCAGTGATACTCAGC -3'
(R):5'- GATTTCTGCCTATAGAACTGAGCC -3'
Posted On2014-03-17