Incidental Mutation 'R1396:Sbk3'
ID162642
Institutional Source Beutler Lab
Gene Symbol Sbk3
Ensembl Gene ENSMUSG00000085272
Gene NameSH3 domain binding kinase family, member 3
SynonymsLOC381835, Gm1078
MMRRC Submission 039458-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.119) question?
Stock #R1396 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location4965260-4971168 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 4967453 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 306 (Y306H)
Ref Sequence ENSEMBL: ENSMUSP00000122507 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032598] [ENSMUST00000133272] [ENSMUST00000144863] [ENSMUST00000182214] [ENSMUST00000183170] [ENSMUST00000208109]
Predicted Effect probably benign
Transcript: ENSMUST00000032598
SMART Domains Protein: ENSMUSP00000032598
Gene: ENSMUSG00000030433

DomainStartEndE-ValueType
low complexity region 15 50 N/A INTRINSIC
Pfam:Pkinase_Tyr 62 296 2.8e-21 PFAM
Pfam:Pkinase 62 329 1.5e-39 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000133272
AA Change: Y325H

PolyPhen 2 Score 0.861 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000120654
Gene: ENSMUSG00000085272
AA Change: Y325H

DomainStartEndE-ValueType
low complexity region 7 18 N/A INTRINSIC
Pfam:Pkinase_Tyr 43 268 1.8e-17 PFAM
Pfam:Pkinase 43 304 1.7e-30 PFAM
Pfam:Kinase-like 130 262 1.6e-8 PFAM
low complexity region 309 321 N/A INTRINSIC
low complexity region 328 347 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000144863
AA Change: Y306H

PolyPhen 2 Score 0.861 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000122507
Gene: ENSMUSG00000085272
AA Change: Y306H

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 24 248 3.1e-17 PFAM
Pfam:Pkinase 24 284 5.6e-32 PFAM
Pfam:Kinase-like 111 237 2.5e-7 PFAM
low complexity region 290 302 N/A INTRINSIC
low complexity region 309 328 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000182214
SMART Domains Protein: ENSMUSP00000138504
Gene: ENSMUSG00000030433

DomainStartEndE-ValueType
low complexity region 15 50 N/A INTRINSIC
Pfam:Pkinase_Tyr 62 296 3.7e-21 PFAM
Pfam:Pkinase 62 329 6.8e-40 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182837
Predicted Effect probably benign
Transcript: ENSMUST00000183170
SMART Domains Protein: ENSMUSP00000138187
Gene: ENSMUSG00000030433

DomainStartEndE-ValueType
low complexity region 15 50 N/A INTRINSIC
Pfam:Pkinase_Tyr 62 211 1.9e-18 PFAM
Pfam:Pkinase 62 212 3.2e-29 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000208109
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.3%
  • 20x: 89.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921530L21Rik A G 14: 95,882,551 N248S probably benign Het
4930486L24Rik G A 13: 60,853,243 P160S probably benign Het
Adamts12 G T 15: 11,311,472 D1272Y probably benign Het
Akr1c20 A T 13: 4,507,727 V267D probably damaging Het
C1s1 A G 6: 124,531,051 S660P probably damaging Het
Ccdc40 A G 11: 119,231,803 T144A possibly damaging Het
Cdk20 T C 13: 64,437,403 I167T probably damaging Het
Chd6 A G 2: 160,983,103 L1212S probably damaging Het
Clock G C 5: 76,266,802 D15E probably benign Het
Clstn2 A G 9: 97,461,393 V667A probably benign Het
Cr2 A T 1: 195,169,253 probably null Het
Cyp2e1 A G 7: 140,773,079 D343G probably damaging Het
Dync1h1 G A 12: 110,636,509 E2195K probably benign Het
Etf1 G A 18: 34,908,167 T298I possibly damaging Het
Gm5431 T C 11: 48,895,434 probably benign Het
Gss G A 2: 155,567,721 T265I probably damaging Het
Heatr1 C T 13: 12,406,046 S406L possibly damaging Het
Hgsnat C A 8: 25,957,335 M310I possibly damaging Het
Inpp5b G A 4: 124,789,080 R598H probably damaging Het
Ints2 G T 11: 86,249,248 Q253K probably damaging Het
Kng1 A G 16: 23,078,980 M377V probably benign Het
Krt72 C T 15: 101,786,005 probably null Het
Lemd2 G C 17: 27,190,732 R482G probably damaging Het
Lrpprc C T 17: 84,726,303 D1049N possibly damaging Het
Lrrc49 A T 9: 60,680,527 H117Q probably damaging Het
Mcm6 A T 1: 128,351,476 F191Y probably damaging Het
Mecom T C 3: 29,979,800 T252A possibly damaging Het
Mgat4e T C 1: 134,541,533 T258A probably benign Het
Mpeg1 A G 19: 12,462,804 N542S probably damaging Het
Nln C T 13: 104,061,753 V184I probably benign Het
Nova1 A C 12: 46,816,893 F91L unknown Het
Polk T C 13: 96,484,208 I516V probably benign Het
Ppig C T 2: 69,749,018 P357S unknown Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Rasal2 A T 1: 157,164,666 H552Q probably damaging Het
Rnf41 G A 10: 128,435,571 E117K probably benign Het
Senp1 A G 15: 98,076,554 S126P probably benign Het
Sfr1 A G 19: 47,733,690 K182E probably benign Het
Slc25a4 C A 8: 46,209,288 R111L probably damaging Het
Slc9c1 A T 16: 45,573,347 Y551F probably benign Het
Stard4 A T 18: 33,206,210 N80K probably damaging Het
Tbk1 G A 10: 121,571,916 T104M probably damaging Het
Tedc2 T A 17: 24,216,317 E366V probably damaging Het
Tedc2 C A 17: 24,216,318 E366* probably null Het
Tmem102 A T 11: 69,804,370 W259R probably damaging Het
Tnk1 A T 11: 69,853,136 C466S probably benign Het
Tspoap1 A C 11: 87,766,120 Q307P probably damaging Het
Ugt2b35 A G 5: 87,011,530 N528D possibly damaging Het
Usp6nl A G 2: 6,426,998 probably null Het
Vmn1r203 C T 13: 22,524,508 T153M probably benign Het
Vmn1r89 T A 7: 13,220,011 S157T probably damaging Het
Vmn2r103 A T 17: 19,792,968 Y117F probably benign Het
Vmn2r116 A C 17: 23,386,141 M143L probably benign Het
Vmn2r62 A T 7: 42,764,837 D727E probably damaging Het
Vps13c A G 9: 67,955,022 I2974V probably benign Het
Wrn C T 8: 33,268,819 G769D probably damaging Het
Zhx3 T A 2: 160,781,020 H409L possibly damaging Het
Other mutations in Sbk3
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0002:Sbk3 UTSW 7 4970631 missense probably damaging 1.00
R0344:Sbk3 UTSW 7 4967405 missense possibly damaging 0.53
R2115:Sbk3 UTSW 7 4967416 missense possibly damaging 0.86
R4073:Sbk3 UTSW 7 4970502 missense probably damaging 1.00
R4298:Sbk3 UTSW 7 4969980 missense probably benign 0.05
R5347:Sbk3 UTSW 7 4967423 missense probably benign 0.18
R5819:Sbk3 UTSW 7 4969997 missense probably benign 0.38
R6535:Sbk3 UTSW 7 4969841 missense possibly damaging 0.78
R6957:Sbk3 UTSW 7 4967523 missense probably benign
Predicted Primers PCR Primer
(F):5'- GCACATCCACATCCAGTGTGTTCC -3'
(R):5'- TTTGACTCGACCTGAAGGCAGC -3'

Sequencing Primer
(F):5'- TCCCCCTTCTCCCAGAACAG -3'
(R):5'- CTGGTTGGATGACCACTAAGC -3'
Posted On2014-03-17