Incidental Mutation 'R1396:Vmn1r89'
ID162643
Institutional Source Beutler Lab
Gene Symbol Vmn1r89
Ensembl Gene ENSMUSG00000095629
Gene Namevomeronasal 1 receptor 89
SynonymsV1rj2
MMRRC Submission 039458-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.151) question?
Stock #R1396 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location13213020-13220657 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 13220011 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 157 (S157T)
Ref Sequence ENSEMBL: ENSMUSP00000154139 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053008] [ENSMUST00000226717] [ENSMUST00000227176] [ENSMUST00000227239] [ENSMUST00000227276] [ENSMUST00000227319] [ENSMUST00000227390] [ENSMUST00000228587]
Predicted Effect probably damaging
Transcript: ENSMUST00000053008
AA Change: S225T

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000096413
Gene: ENSMUSG00000095629
AA Change: S225T

DomainStartEndE-ValueType
Pfam:TAS2R 1 306 1.9e-15 PFAM
Pfam:7tm_1 25 295 1.1e-6 PFAM
Pfam:V1R 36 301 1.5e-34 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000226717
AA Change: S225T

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Predicted Effect probably damaging
Transcript: ENSMUST00000227176
AA Change: S225T

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Predicted Effect probably damaging
Transcript: ENSMUST00000227239
AA Change: S225T

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Predicted Effect probably damaging
Transcript: ENSMUST00000227276
AA Change: S180T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000227319
AA Change: S36T

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
Predicted Effect probably damaging
Transcript: ENSMUST00000227390
AA Change: S157T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000228587
AA Change: S225T

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228795
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228825
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.3%
  • 20x: 89.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921530L21Rik A G 14: 95,882,551 N248S probably benign Het
4930486L24Rik G A 13: 60,853,243 P160S probably benign Het
Adamts12 G T 15: 11,311,472 D1272Y probably benign Het
Akr1c20 A T 13: 4,507,727 V267D probably damaging Het
C1s1 A G 6: 124,531,051 S660P probably damaging Het
Ccdc40 A G 11: 119,231,803 T144A possibly damaging Het
Cdk20 T C 13: 64,437,403 I167T probably damaging Het
Chd6 A G 2: 160,983,103 L1212S probably damaging Het
Clock G C 5: 76,266,802 D15E probably benign Het
Clstn2 A G 9: 97,461,393 V667A probably benign Het
Cr2 A T 1: 195,169,253 probably null Het
Cyp2e1 A G 7: 140,773,079 D343G probably damaging Het
Dync1h1 G A 12: 110,636,509 E2195K probably benign Het
Etf1 G A 18: 34,908,167 T298I possibly damaging Het
Gm5431 T C 11: 48,895,434 probably benign Het
Gss G A 2: 155,567,721 T265I probably damaging Het
Heatr1 C T 13: 12,406,046 S406L possibly damaging Het
Hgsnat C A 8: 25,957,335 M310I possibly damaging Het
Inpp5b G A 4: 124,789,080 R598H probably damaging Het
Ints2 G T 11: 86,249,248 Q253K probably damaging Het
Kng1 A G 16: 23,078,980 M377V probably benign Het
Krt72 C T 15: 101,786,005 probably null Het
Lemd2 G C 17: 27,190,732 R482G probably damaging Het
Lrpprc C T 17: 84,726,303 D1049N possibly damaging Het
Lrrc49 A T 9: 60,680,527 H117Q probably damaging Het
Mcm6 A T 1: 128,351,476 F191Y probably damaging Het
Mecom T C 3: 29,979,800 T252A possibly damaging Het
Mgat4e T C 1: 134,541,533 T258A probably benign Het
Mpeg1 A G 19: 12,462,804 N542S probably damaging Het
Nln C T 13: 104,061,753 V184I probably benign Het
Nova1 A C 12: 46,816,893 F91L unknown Het
Polk T C 13: 96,484,208 I516V probably benign Het
Ppig C T 2: 69,749,018 P357S unknown Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Rasal2 A T 1: 157,164,666 H552Q probably damaging Het
Rnf41 G A 10: 128,435,571 E117K probably benign Het
Sbk3 A G 7: 4,967,453 Y306H possibly damaging Het
Senp1 A G 15: 98,076,554 S126P probably benign Het
Sfr1 A G 19: 47,733,690 K182E probably benign Het
Slc25a4 C A 8: 46,209,288 R111L probably damaging Het
Slc9c1 A T 16: 45,573,347 Y551F probably benign Het
Stard4 A T 18: 33,206,210 N80K probably damaging Het
Tbk1 G A 10: 121,571,916 T104M probably damaging Het
Tedc2 T A 17: 24,216,317 E366V probably damaging Het
Tedc2 C A 17: 24,216,318 E366* probably null Het
Tmem102 A T 11: 69,804,370 W259R probably damaging Het
Tnk1 A T 11: 69,853,136 C466S probably benign Het
Tspoap1 A C 11: 87,766,120 Q307P probably damaging Het
Ugt2b35 A G 5: 87,011,530 N528D possibly damaging Het
Usp6nl A G 2: 6,426,998 probably null Het
Vmn1r203 C T 13: 22,524,508 T153M probably benign Het
Vmn2r103 A T 17: 19,792,968 Y117F probably benign Het
Vmn2r116 A C 17: 23,386,141 M143L probably benign Het
Vmn2r62 A T 7: 42,764,837 D727E probably damaging Het
Vps13c A G 9: 67,955,022 I2974V probably benign Het
Wrn C T 8: 33,268,819 G769D probably damaging Het
Zhx3 T A 2: 160,781,020 H409L possibly damaging Het
Other mutations in Vmn1r89
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01569:Vmn1r89 APN 7 13219505 missense probably benign 0.28
IGL02085:Vmn1r89 APN 7 13219538 missense probably damaging 0.96
IGL02694:Vmn1r89 APN 7 13220129 missense probably benign 0.12
IGL02709:Vmn1r89 APN 7 13220204 missense probably damaging 1.00
PIT4142001:Vmn1r89 UTSW 7 13219588 missense probably benign
R0765:Vmn1r89 UTSW 7 13219540 missense probably benign 0.03
R2249:Vmn1r89 UTSW 7 13220260 missense possibly damaging 0.90
R4296:Vmn1r89 UTSW 7 13220186 missense possibly damaging 0.78
R4472:Vmn1r89 UTSW 7 13219872 missense probably benign 0.04
R5037:Vmn1r89 UTSW 7 13219387 missense possibly damaging 0.88
R5267:Vmn1r89 UTSW 7 13220213 missense probably damaging 1.00
R5352:Vmn1r89 UTSW 7 13219357 missense probably benign
R5455:Vmn1r89 UTSW 7 13220267 missense probably benign 0.01
R5595:Vmn1r89 UTSW 7 13219930 missense possibly damaging 0.93
R5643:Vmn1r89 UTSW 7 13220219 missense possibly damaging 0.94
R7493:Vmn1r89 UTSW 7 13219705 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCCAGTAACTCTAAGTGGGCCTC -3'
(R):5'- CAGCCATGCAGTGAACTTTGATGAC -3'

Sequencing Primer
(F):5'- GGCTTATTAACCTAGTCATCTACGGG -3'
(R):5'- TGTCATCCTCAGTACCGAAAATG -3'
Posted On2014-03-17