Incidental Mutation 'R1396:Cyp2e1'
ID162645
Institutional Source Beutler Lab
Gene Symbol Cyp2e1
Ensembl Gene ENSMUSG00000025479
Gene Namecytochrome P450, family 2, subfamily e, polypeptide 1
SynonymsCyp2e
MMRRC Submission 039458-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1396 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location140763739-140774987 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 140773079 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 343 (D343G)
Ref Sequence ENSEMBL: ENSMUSP00000026552 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026552] [ENSMUST00000026553] [ENSMUST00000209253] [ENSMUST00000210235]
Predicted Effect probably damaging
Transcript: ENSMUST00000026552
AA Change: D343G

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000026552
Gene: ENSMUSG00000025479
AA Change: D343G

DomainStartEndE-ValueType
transmembrane domain 2 23 N/A INTRINSIC
Pfam:p450 33 489 1.4e-147 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000026553
SMART Domains Protein: ENSMUSP00000026553
Gene: ENSMUSG00000025480

DomainStartEndE-ValueType
Pfam:SYCE1 49 200 5.5e-66 PFAM
coiled coil region 237 294 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000209253
AA Change: D284G

PolyPhen 2 Score 0.928 (Sensitivity: 0.81; Specificity: 0.94)
Predicted Effect unknown
Transcript: ENSMUST00000210235
AA Change: D183G
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210403
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.3%
  • 20x: 89.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the cytochrome P450 superfamily of enzymes. The cytochrome P450 proteins are monooxygenases which catalyze many reactions involved in drug metabolism and synthesis of cholesterol, steroids and other lipids. This protein localizes to the endoplasmic reticulum and is induced by ethanol, the diabetic state, and starvation. The enzyme metabolizes both endogenous substrates, such as ethanol, acetone, and acetal, as well as exogenous substrates including benzene, carbon tetrachloride, ethylene glycol, and nitrosamines which are premutagens found in cigarette smoke. Due to its many substrates, this enzyme may be involved in such varied processes as gluconeogenesis, hepatic cirrhosis, diabetes, and cancer. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit altered responses to xenobiotics including decreased urethane-induced tumors and allylnitrile- or acetamenophen-associated mortality but increased allylnitrile-induced vestibular function loss. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921530L21Rik A G 14: 95,882,551 N248S probably benign Het
4930486L24Rik G A 13: 60,853,243 P160S probably benign Het
Adamts12 G T 15: 11,311,472 D1272Y probably benign Het
Akr1c20 A T 13: 4,507,727 V267D probably damaging Het
C1s1 A G 6: 124,531,051 S660P probably damaging Het
Ccdc40 A G 11: 119,231,803 T144A possibly damaging Het
Cdk20 T C 13: 64,437,403 I167T probably damaging Het
Chd6 A G 2: 160,983,103 L1212S probably damaging Het
Clock G C 5: 76,266,802 D15E probably benign Het
Clstn2 A G 9: 97,461,393 V667A probably benign Het
Cr2 A T 1: 195,169,253 probably null Het
Dync1h1 G A 12: 110,636,509 E2195K probably benign Het
Etf1 G A 18: 34,908,167 T298I possibly damaging Het
Gm5431 T C 11: 48,895,434 probably benign Het
Gss G A 2: 155,567,721 T265I probably damaging Het
Heatr1 C T 13: 12,406,046 S406L possibly damaging Het
Hgsnat C A 8: 25,957,335 M310I possibly damaging Het
Inpp5b G A 4: 124,789,080 R598H probably damaging Het
Ints2 G T 11: 86,249,248 Q253K probably damaging Het
Kng1 A G 16: 23,078,980 M377V probably benign Het
Krt72 C T 15: 101,786,005 probably null Het
Lemd2 G C 17: 27,190,732 R482G probably damaging Het
Lrpprc C T 17: 84,726,303 D1049N possibly damaging Het
Lrrc49 A T 9: 60,680,527 H117Q probably damaging Het
Mcm6 A T 1: 128,351,476 F191Y probably damaging Het
Mecom T C 3: 29,979,800 T252A possibly damaging Het
Mgat4e T C 1: 134,541,533 T258A probably benign Het
Mpeg1 A G 19: 12,462,804 N542S probably damaging Het
Nln C T 13: 104,061,753 V184I probably benign Het
Nova1 A C 12: 46,816,893 F91L unknown Het
Polk T C 13: 96,484,208 I516V probably benign Het
Ppig C T 2: 69,749,018 P357S unknown Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Rasal2 A T 1: 157,164,666 H552Q probably damaging Het
Rnf41 G A 10: 128,435,571 E117K probably benign Het
Sbk3 A G 7: 4,967,453 Y306H possibly damaging Het
Senp1 A G 15: 98,076,554 S126P probably benign Het
Sfr1 A G 19: 47,733,690 K182E probably benign Het
Slc25a4 C A 8: 46,209,288 R111L probably damaging Het
Slc9c1 A T 16: 45,573,347 Y551F probably benign Het
Stard4 A T 18: 33,206,210 N80K probably damaging Het
Tbk1 G A 10: 121,571,916 T104M probably damaging Het
Tedc2 T A 17: 24,216,317 E366V probably damaging Het
Tedc2 C A 17: 24,216,318 E366* probably null Het
Tmem102 A T 11: 69,804,370 W259R probably damaging Het
Tnk1 A T 11: 69,853,136 C466S probably benign Het
Tspoap1 A C 11: 87,766,120 Q307P probably damaging Het
Ugt2b35 A G 5: 87,011,530 N528D possibly damaging Het
Usp6nl A G 2: 6,426,998 probably null Het
Vmn1r203 C T 13: 22,524,508 T153M probably benign Het
Vmn1r89 T A 7: 13,220,011 S157T probably damaging Het
Vmn2r103 A T 17: 19,792,968 Y117F probably benign Het
Vmn2r116 A C 17: 23,386,141 M143L probably benign Het
Vmn2r62 A T 7: 42,764,837 D727E probably damaging Het
Vps13c A G 9: 67,955,022 I2974V probably benign Het
Wrn C T 8: 33,268,819 G769D probably damaging Het
Zhx3 T A 2: 160,781,020 H409L possibly damaging Het
Other mutations in Cyp2e1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00706:Cyp2e1 APN 7 140769153 missense probably benign 0.17
IGL01755:Cyp2e1 APN 7 140774556 critical splice acceptor site probably null
IGL01884:Cyp2e1 APN 7 140773750 missense probably benign 0.16
IGL01950:Cyp2e1 APN 7 140764961 critical splice donor site probably null
IGL01964:Cyp2e1 APN 7 140763866 missense probably damaging 1.00
IGL02430:Cyp2e1 APN 7 140770226 missense probably damaging 1.00
IGL02505:Cyp2e1 APN 7 140769156 missense probably damaging 1.00
IGL02596:Cyp2e1 APN 7 140770118 missense probably damaging 0.99
IGL02725:Cyp2e1 APN 7 140763915 missense probably null 1.00
IGL02887:Cyp2e1 APN 7 140763911 missense probably damaging 1.00
IGL03114:Cyp2e1 APN 7 140773129 missense possibly damaging 0.95
IGL03146:Cyp2e1 APN 7 140770221 missense probably benign 0.00
IGL03340:Cyp2e1 APN 7 140764854 missense probably damaging 1.00
R2111:Cyp2e1 UTSW 7 140773634 missense probably damaging 1.00
R2230:Cyp2e1 UTSW 7 140764914 missense probably damaging 1.00
R2231:Cyp2e1 UTSW 7 140764914 missense probably damaging 1.00
R2383:Cyp2e1 UTSW 7 140770068 missense probably benign 0.06
R3778:Cyp2e1 UTSW 7 140763909 missense possibly damaging 0.58
R4082:Cyp2e1 UTSW 7 140771078 missense possibly damaging 0.67
R4707:Cyp2e1 UTSW 7 140763908 missense possibly damaging 0.58
R4751:Cyp2e1 UTSW 7 140774716 nonsense probably null
R4784:Cyp2e1 UTSW 7 140763908 missense possibly damaging 0.58
R4792:Cyp2e1 UTSW 7 140773675 missense probably benign
R4917:Cyp2e1 UTSW 7 140774614 missense possibly damaging 0.94
R4934:Cyp2e1 UTSW 7 140770117 missense probably damaging 1.00
R5092:Cyp2e1 UTSW 7 140774735 missense probably damaging 1.00
R5388:Cyp2e1 UTSW 7 140763993 missense probably damaging 1.00
R5423:Cyp2e1 UTSW 7 140770118 missense probably benign 0.01
R6740:Cyp2e1 UTSW 7 140763780 unclassified probably benign
R7065:Cyp2e1 UTSW 7 140763993 missense probably damaging 1.00
R7154:Cyp2e1 UTSW 7 140770137 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AATGGAACTATTGCAGGATCGTGGG -3'
(R):5'- ACCTCGGCGATAAGCTAACAGGAC -3'

Sequencing Primer
(F):5'- GCTATACTGGTGGGTAAATGAATATG -3'
(R):5'- CGATAAGCTAACAGGACAATGC -3'
Posted On2014-03-17