Incidental Mutation 'R1396:Hgsnat'
ID162646
Institutional Source Beutler Lab
Gene Symbol Hgsnat
Ensembl Gene ENSMUSG00000037260
Gene Nameheparan-alpha-glucosaminide N-acetyltransferase
SynonymsD8Ertd354e, 9430010M12Rik, Tmem76
MMRRC Submission 039458-MU
Accession Numbers

Ncbi RefSeq: NM_029884.1; MGI:1196297

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1396 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location25944453-25976753 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 25957335 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Isoleucine at position 310 (M310I)
Ref Sequence ENSEMBL: ENSMUSP00000040356 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037609]
Predicted Effect possibly damaging
Transcript: ENSMUST00000037609
AA Change: M310I

PolyPhen 2 Score 0.949 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000040356
Gene: ENSMUSG00000037260
AA Change: M310I

DomainStartEndE-ValueType
low complexity region 2 23 N/A INTRINSIC
transmembrane domain 33 55 N/A INTRINSIC
transmembrane domain 189 211 N/A INTRINSIC
Pfam:DUF1624 260 434 6.8e-11 PFAM
Pfam:DUF5009 286 389 2.4e-10 PFAM
transmembrane domain 494 516 N/A INTRINSIC
transmembrane domain 523 545 N/A INTRINSIC
transmembrane domain 560 582 N/A INTRINSIC
transmembrane domain 587 609 N/A INTRINSIC
transmembrane domain 629 648 N/A INTRINSIC
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.3%
  • 20x: 89.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a lysosomal acetyltransferase, which is one of several enzymes involved in the lysosomal degradation of heparin sulfate. Mutations in this gene are associated with Sanfilippo syndrome C, one type of the lysosomal storage disease mucopolysaccaridosis III, which results from impaired degradation of heparan sulfate. [provided by RefSeq, Jan 2009]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit progressive storage pathology in the CNS and peripheral organs, glycosaminoglycan accumulation in brain and most somatic organs, lysosomal distension and dysfunction, astrocytosis, microgliosis, hepatosplenomegaly, behavioral deficits and premature death. [provided by MGI curators]
Allele List at MGI

All alleles(9) : Targeted(3) Gene trapped(6)

Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921530L21Rik A G 14: 95,882,551 N248S probably benign Het
4930486L24Rik G A 13: 60,853,243 P160S probably benign Het
Adamts12 G T 15: 11,311,472 D1272Y probably benign Het
Akr1c20 A T 13: 4,507,727 V267D probably damaging Het
C1s1 A G 6: 124,531,051 S660P probably damaging Het
Ccdc40 A G 11: 119,231,803 T144A possibly damaging Het
Cdk20 T C 13: 64,437,403 I167T probably damaging Het
Chd6 A G 2: 160,983,103 L1212S probably damaging Het
Clock G C 5: 76,266,802 D15E probably benign Het
Clstn2 A G 9: 97,461,393 V667A probably benign Het
Cr2 A T 1: 195,169,253 probably null Het
Cyp2e1 A G 7: 140,773,079 D343G probably damaging Het
Dync1h1 G A 12: 110,636,509 E2195K probably benign Het
Etf1 G A 18: 34,908,167 T298I possibly damaging Het
Gm5431 T C 11: 48,895,434 probably benign Het
Gss G A 2: 155,567,721 T265I probably damaging Het
Heatr1 C T 13: 12,406,046 S406L possibly damaging Het
Inpp5b G A 4: 124,789,080 R598H probably damaging Het
Ints2 G T 11: 86,249,248 Q253K probably damaging Het
Kng1 A G 16: 23,078,980 M377V probably benign Het
Krt72 C T 15: 101,786,005 probably null Het
Lemd2 G C 17: 27,190,732 R482G probably damaging Het
Lrpprc C T 17: 84,726,303 D1049N possibly damaging Het
Lrrc49 A T 9: 60,680,527 H117Q probably damaging Het
Mcm6 A T 1: 128,351,476 F191Y probably damaging Het
Mecom T C 3: 29,979,800 T252A possibly damaging Het
Mgat4e T C 1: 134,541,533 T258A probably benign Het
Mpeg1 A G 19: 12,462,804 N542S probably damaging Het
Nln C T 13: 104,061,753 V184I probably benign Het
Nova1 A C 12: 46,816,893 F91L unknown Het
Polk T C 13: 96,484,208 I516V probably benign Het
Ppig C T 2: 69,749,018 P357S unknown Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Rasal2 A T 1: 157,164,666 H552Q probably damaging Het
Rnf41 G A 10: 128,435,571 E117K probably benign Het
Sbk3 A G 7: 4,967,453 Y306H possibly damaging Het
Senp1 A G 15: 98,076,554 S126P probably benign Het
Sfr1 A G 19: 47,733,690 K182E probably benign Het
Slc25a4 C A 8: 46,209,288 R111L probably damaging Het
Slc9c1 A T 16: 45,573,347 Y551F probably benign Het
Stard4 A T 18: 33,206,210 N80K probably damaging Het
Tbk1 G A 10: 121,571,916 T104M probably damaging Het
Tedc2 T A 17: 24,216,317 E366V probably damaging Het
Tedc2 C A 17: 24,216,318 E366* probably null Het
Tmem102 A T 11: 69,804,370 W259R probably damaging Het
Tnk1 A T 11: 69,853,136 C466S probably benign Het
Tspoap1 A C 11: 87,766,120 Q307P probably damaging Het
Ugt2b35 A G 5: 87,011,530 N528D possibly damaging Het
Usp6nl A G 2: 6,426,998 probably null Het
Vmn1r203 C T 13: 22,524,508 T153M probably benign Het
Vmn1r89 T A 7: 13,220,011 S157T probably damaging Het
Vmn2r103 A T 17: 19,792,968 Y117F probably benign Het
Vmn2r116 A C 17: 23,386,141 M143L probably benign Het
Vmn2r62 A T 7: 42,764,837 D727E probably damaging Het
Vps13c A G 9: 67,955,022 I2974V probably benign Het
Wrn C T 8: 33,268,819 G769D probably damaging Het
Zhx3 T A 2: 160,781,020 H409L possibly damaging Het
Other mutations in Hgsnat
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00661:Hgsnat APN 8 25972937 missense probably benign 0.04
IGL02950:Hgsnat APN 8 25971701 missense probably damaging 1.00
IGL03145:Hgsnat APN 8 25946452 missense probably damaging 1.00
ample UTSW 8 25947960 nonsense probably null
generous UTSW 8 25968361 critical splice donor site probably null
P0018:Hgsnat UTSW 8 25968354 unclassified probably benign
PIT4305001:Hgsnat UTSW 8 25945199 missense possibly damaging 0.67
R1676:Hgsnat UTSW 8 25954605 critical splice donor site probably null
R1856:Hgsnat UTSW 8 25957256 missense probably benign 0.06
R1998:Hgsnat UTSW 8 25945252 nonsense probably null
R2497:Hgsnat UTSW 8 25945252 nonsense probably null
R2570:Hgsnat UTSW 8 25945252 nonsense probably null
R4012:Hgsnat UTSW 8 25955789 nonsense probably null
R4080:Hgsnat UTSW 8 25946343 missense probably benign 0.02
R4462:Hgsnat UTSW 8 25954636 missense probably damaging 1.00
R4523:Hgsnat UTSW 8 25968361 critical splice donor site probably null
R4914:Hgsnat UTSW 8 25964838 missense probably damaging 0.98
R5010:Hgsnat UTSW 8 25947960 nonsense probably null
R5561:Hgsnat UTSW 8 25946334 missense possibly damaging 0.90
R5889:Hgsnat UTSW 8 25963367 missense probably damaging 1.00
R6411:Hgsnat UTSW 8 25946275 missense possibly damaging 0.88
R6520:Hgsnat UTSW 8 25953300 missense probably damaging 1.00
R6524:Hgsnat UTSW 8 25945232 missense probably damaging 1.00
R7230:Hgsnat UTSW 8 25954832 intron probably null
R7462:Hgsnat UTSW 8 25957213 missense probably benign 0.45
R7509:Hgsnat UTSW 8 25955726 missense probably damaging 0.98
R7526:Hgsnat UTSW 8 25971049 missense probably damaging 1.00
R7583:Hgsnat UTSW 8 25971564 critical splice donor site probably null
R7679:Hgsnat UTSW 8 25954637 missense probably damaging 1.00
R8111:Hgsnat UTSW 8 25968412 missense probably benign 0.00
R8206:Hgsnat UTSW 8 25954637 missense probably damaging 1.00
R8321:Hgsnat UTSW 8 25971151 missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- ACTCCGTCGGAAGAACTCCATCAG -3'
(R):5'- AGCCAACAGGGCTGTGTTTGTG -3'

Sequencing Primer
(F):5'- tgggtttgctcccaaatactg -3'
(R):5'- GTGCCCCTCATGTATTATGAGC -3'
Posted On2014-03-17