Incidental Mutation 'R1396:Lrrc49'
ID 162649
Institutional Source Beutler Lab
Gene Symbol Lrrc49
Ensembl Gene ENSMUSG00000047766
Gene Name leucine rich repeat containing 49
Synonyms D430025H09Rik
MMRRC Submission 039458-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.091) question?
Stock # R1396 (G1)
Quality Score 225
Status Not validated
Chromosome 9
Chromosomal Location 60568859-60688158 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 60680527 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Histidine to Glutamine at position 117 (H117Q)
Ref Sequence ENSEMBL: ENSMUSP00000121491 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065603] [ENSMUST00000114032] [ENSMUST00000114034] [ENSMUST00000132366] [ENSMUST00000150060] [ENSMUST00000166168]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000065603
AA Change: H123Q

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000070606
Gene: ENSMUSG00000047766
AA Change: H123Q

DomainStartEndE-ValueType
LRR 199 221 2.84e1 SMART
LRR 243 264 1.49e1 SMART
LRR 265 286 1.37e2 SMART
LRR 287 308 1.62e1 SMART
LRR 309 332 6.77e0 SMART
low complexity region 378 394 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000114032
SMART Domains Protein: ENSMUSP00000109666
Gene: ENSMUSG00000047766

DomainStartEndE-ValueType
LRR 127 149 2.84e1 SMART
LRR 171 192 1.49e1 SMART
LRR 193 214 1.37e2 SMART
LRR 215 236 1.62e1 SMART
LRR 237 260 6.77e0 SMART
low complexity region 306 322 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000114034
SMART Domains Protein: ENSMUSP00000109668
Gene: ENSMUSG00000047766

DomainStartEndE-ValueType
LRR 133 155 2.84e1 SMART
LRR 177 198 1.49e1 SMART
LRR 199 220 1.37e2 SMART
LRR 221 242 1.62e1 SMART
LRR 243 266 6.77e0 SMART
low complexity region 312 328 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128877
Predicted Effect probably damaging
Transcript: ENSMUST00000132366
AA Change: H117Q

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
Predicted Effect probably benign
Transcript: ENSMUST00000150060
SMART Domains Protein: ENSMUSP00000118205
Gene: ENSMUSG00000047766

DomainStartEndE-ValueType
LRR 133 155 2.84e1 SMART
LRR 177 198 1.49e1 SMART
LRR 199 220 1.37e2 SMART
LRR 221 242 1.62e1 SMART
LRR 243 266 6.77e0 SMART
low complexity region 312 328 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000166168
AA Change: H117Q

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000128842
Gene: ENSMUSG00000047766
AA Change: H117Q

DomainStartEndE-ValueType
LRR 193 215 2.84e1 SMART
LRR 237 258 1.49e1 SMART
LRR 259 280 1.37e2 SMART
LRR 281 302 1.62e1 SMART
LRR 303 326 6.77e0 SMART
low complexity region 372 388 N/A INTRINSIC
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.3%
  • 20x: 89.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921530L21Rik A G 14: 95,882,551 N248S probably benign Het
4930486L24Rik G A 13: 60,853,243 P160S probably benign Het
Adamts12 G T 15: 11,311,472 D1272Y probably benign Het
Akr1c20 A T 13: 4,507,727 V267D probably damaging Het
C1s1 A G 6: 124,531,051 S660P probably damaging Het
Ccdc40 A G 11: 119,231,803 T144A possibly damaging Het
Cdk20 T C 13: 64,437,403 I167T probably damaging Het
Chd6 A G 2: 160,983,103 L1212S probably damaging Het
Clock G C 5: 76,266,802 D15E probably benign Het
Clstn2 A G 9: 97,461,393 V667A probably benign Het
Cr2 A T 1: 195,169,253 probably null Het
Cyp2e1 A G 7: 140,773,079 D343G probably damaging Het
Dync1h1 G A 12: 110,636,509 E2195K probably benign Het
Etf1 G A 18: 34,908,167 T298I possibly damaging Het
Gm5431 T C 11: 48,895,434 probably benign Het
Gss G A 2: 155,567,721 T265I probably damaging Het
Heatr1 C T 13: 12,406,046 S406L possibly damaging Het
Hgsnat C A 8: 25,957,335 M310I possibly damaging Het
Inpp5b G A 4: 124,789,080 R598H probably damaging Het
Ints2 G T 11: 86,249,248 Q253K probably damaging Het
Kng1 A G 16: 23,078,980 M377V probably benign Het
Krt72 C T 15: 101,786,005 probably null Het
Lemd2 G C 17: 27,190,732 R482G probably damaging Het
Lrpprc C T 17: 84,726,303 D1049N possibly damaging Het
Mcm6 A T 1: 128,351,476 F191Y probably damaging Het
Mecom T C 3: 29,979,800 T252A possibly damaging Het
Mgat4e T C 1: 134,541,533 T258A probably benign Het
Mpeg1 A G 19: 12,462,804 N542S probably damaging Het
Nln C T 13: 104,061,753 V184I probably benign Het
Nova1 A C 12: 46,816,893 F91L unknown Het
Polk T C 13: 96,484,208 I516V probably benign Het
Ppig C T 2: 69,749,018 P357S unknown Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Rasal2 A T 1: 157,164,666 H552Q probably damaging Het
Rnf41 G A 10: 128,435,571 E117K probably benign Het
Sbk3 A G 7: 4,967,453 Y306H possibly damaging Het
Senp1 A G 15: 98,076,554 S126P probably benign Het
Sfr1 A G 19: 47,733,690 K182E probably benign Het
Slc25a4 C A 8: 46,209,288 R111L probably damaging Het
Slc9c1 A T 16: 45,573,347 Y551F probably benign Het
Stard4 A T 18: 33,206,210 N80K probably damaging Het
Tbk1 G A 10: 121,571,916 T104M probably damaging Het
Tedc2 T A 17: 24,216,317 E366V probably damaging Het
Tedc2 C A 17: 24,216,318 E366* probably null Het
Tmem102 A T 11: 69,804,370 W259R probably damaging Het
Tnk1 A T 11: 69,853,136 C466S probably benign Het
Tspoap1 A C 11: 87,766,120 Q307P probably damaging Het
Ugt2b35 A G 5: 87,011,530 N528D possibly damaging Het
Usp6nl A G 2: 6,426,998 probably null Het
Vmn1r203 C T 13: 22,524,508 T153M probably benign Het
Vmn1r89 T A 7: 13,220,011 S157T probably damaging Het
Vmn2r103 A T 17: 19,792,968 Y117F probably benign Het
Vmn2r116 A C 17: 23,386,141 M143L probably benign Het
Vmn2r62 A T 7: 42,764,837 D727E probably damaging Het
Vps13c A G 9: 67,955,022 I2974V probably benign Het
Wrn C T 8: 33,268,819 G769D probably damaging Het
Zhx3 T A 2: 160,781,020 H409L possibly damaging Het
Other mutations in Lrrc49
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00156:Lrrc49 APN 9 60601320 missense probably damaging 1.00
IGL00468:Lrrc49 APN 9 60687868 unclassified probably benign
IGL00792:Lrrc49 APN 9 60687838 missense probably damaging 0.97
IGL02252:Lrrc49 APN 9 60687859 start codon destroyed probably benign 0.04
IGL02830:Lrrc49 APN 9 60685110 missense probably damaging 1.00
IGL03103:Lrrc49 APN 9 60685033 critical splice donor site probably null
IGL03223:Lrrc49 APN 9 60687845 missense possibly damaging 0.72
IGL03244:Lrrc49 APN 9 60587857 missense probably damaging 1.00
IGL03392:Lrrc49 APN 9 60666280 splice site probably benign
IGL02837:Lrrc49 UTSW 9 60610322 missense probably benign 0.00
R0164:Lrrc49 UTSW 9 60680600 missense probably benign 0.26
R0164:Lrrc49 UTSW 9 60680600 missense probably benign 0.26
R0335:Lrrc49 UTSW 9 60677095 missense probably damaging 0.99
R0399:Lrrc49 UTSW 9 60610246 splice site probably benign
R0607:Lrrc49 UTSW 9 60666357 missense probably benign 0.35
R1731:Lrrc49 UTSW 9 60621631 missense probably damaging 1.00
R1800:Lrrc49 UTSW 9 60598191 missense probably damaging 1.00
R1817:Lrrc49 UTSW 9 60602776 missense possibly damaging 0.94
R1876:Lrrc49 UTSW 9 60587777 missense possibly damaging 0.77
R1925:Lrrc49 UTSW 9 60649490 missense probably benign 0.07
R2172:Lrrc49 UTSW 9 60602682 missense probably benign 0.25
R2233:Lrrc49 UTSW 9 60598157 missense possibly damaging 0.57
R2235:Lrrc49 UTSW 9 60598157 missense possibly damaging 0.57
R2927:Lrrc49 UTSW 9 60593746 nonsense probably null
R3955:Lrrc49 UTSW 9 60671359 missense probably damaging 1.00
R4214:Lrrc49 UTSW 9 60666326 missense probably benign 0.33
R4772:Lrrc49 UTSW 9 60685052 missense possibly damaging 0.93
R5283:Lrrc49 UTSW 9 60687178 missense probably benign 0.06
R5801:Lrrc49 UTSW 9 60602633 missense probably damaging 1.00
R6115:Lrrc49 UTSW 9 60615161 missense possibly damaging 0.61
R6488:Lrrc49 UTSW 9 60602633 missense probably damaging 1.00
R6525:Lrrc49 UTSW 9 60598149 missense probably damaging 1.00
R6540:Lrrc49 UTSW 9 60685052 missense possibly damaging 0.93
R6550:Lrrc49 UTSW 9 60677147 missense probably benign 0.13
R6603:Lrrc49 UTSW 9 60593769 splice site probably null
R6878:Lrrc49 UTSW 9 60680148 missense probably damaging 0.99
R7144:Lrrc49 UTSW 9 60615156 missense probably damaging 0.99
R7336:Lrrc49 UTSW 9 60677191 missense possibly damaging 0.92
R7541:Lrrc49 UTSW 9 60610403 missense probably damaging 1.00
R7608:Lrrc49 UTSW 9 60602722 missense probably null 1.00
R7739:Lrrc49 UTSW 9 60593692 missense probably benign
R8097:Lrrc49 UTSW 9 60615048 missense probably benign
R8220:Lrrc49 UTSW 9 60610330 missense probably benign
R8442:Lrrc49 UTSW 9 60593625 missense probably benign 0.01
R8458:Lrrc49 UTSW 9 60598173 missense probably benign 0.00
R8692:Lrrc49 UTSW 9 60687162 missense probably damaging 0.97
R9036:Lrrc49 UTSW 9 60587867 missense probably benign 0.17
R9126:Lrrc49 UTSW 9 60671311 missense probably damaging 1.00
R9339:Lrrc49 UTSW 9 60602748 missense probably benign 0.04
R9456:Lrrc49 UTSW 9 60687416 missense probably benign 0.01
R9661:Lrrc49 UTSW 9 60666299 missense probably damaging 1.00
Z1176:Lrrc49 UTSW 9 60677221 missense probably damaging 0.99
Z1177:Lrrc49 UTSW 9 60598093 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- GGGGTTGCTGTCTTCTTCTCAACAC -3'
(R):5'- CATGGGGCATCAACATTCTCTCTGG -3'

Sequencing Primer
(F):5'- AACACTAAGCTCTGTGCTCTGTG -3'
(R):5'- GCAGCATCCTCTAGTAATAGTAGC -3'
Posted On 2014-03-17