Incidental Mutation 'R1396:Clstn2'
ID162652
Institutional Source Beutler Lab
Gene Symbol Clstn2
Ensembl Gene ENSMUSG00000032452
Gene Namecalsyntenin 2
SynonymsCst-2, CSTN2, CS2, 2900042C18Rik
MMRRC Submission 039458-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1396 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location97444395-98033181 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 97461393 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 667 (V667A)
Ref Sequence ENSEMBL: ENSMUSP00000124081 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035027] [ENSMUST00000162295]
Predicted Effect probably benign
Transcript: ENSMUST00000035027
AA Change: V667A

PolyPhen 2 Score 0.021 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000035027
Gene: ENSMUSG00000032452
AA Change: V667A

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
CA 67 160 2e-10 SMART
CA 183 261 1.18e-3 SMART
SCOP:d1a8d_1 358 538 5e-21 SMART
Blast:LamG 380 529 3e-41 BLAST
transmembrane domain 835 857 N/A INTRINSIC
low complexity region 901 935 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000162295
AA Change: V667A

PolyPhen 2 Score 0.021 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000124081
Gene: ENSMUSG00000032452
AA Change: V667A

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
CA 67 160 2e-10 SMART
CA 183 261 1.18e-3 SMART
Pfam:Laminin_G_3 356 533 1.4e-9 PFAM
transmembrane domain 835 857 N/A INTRINSIC
low complexity region 901 935 N/A INTRINSIC
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.3%
  • 20x: 89.4%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous KO mice display deficiency in spatial learning and memory in Morris water and Barnes maze tasks and increased locomotor activity in open field test. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921530L21Rik A G 14: 95,882,551 N248S probably benign Het
4930486L24Rik G A 13: 60,853,243 P160S probably benign Het
Adamts12 G T 15: 11,311,472 D1272Y probably benign Het
Akr1c20 A T 13: 4,507,727 V267D probably damaging Het
C1s1 A G 6: 124,531,051 S660P probably damaging Het
Ccdc40 A G 11: 119,231,803 T144A possibly damaging Het
Cdk20 T C 13: 64,437,403 I167T probably damaging Het
Chd6 A G 2: 160,983,103 L1212S probably damaging Het
Clock G C 5: 76,266,802 D15E probably benign Het
Cr2 A T 1: 195,169,253 probably null Het
Cyp2e1 A G 7: 140,773,079 D343G probably damaging Het
Dync1h1 G A 12: 110,636,509 E2195K probably benign Het
Etf1 G A 18: 34,908,167 T298I possibly damaging Het
Gm5431 T C 11: 48,895,434 probably benign Het
Gss G A 2: 155,567,721 T265I probably damaging Het
Heatr1 C T 13: 12,406,046 S406L possibly damaging Het
Hgsnat C A 8: 25,957,335 M310I possibly damaging Het
Inpp5b G A 4: 124,789,080 R598H probably damaging Het
Ints2 G T 11: 86,249,248 Q253K probably damaging Het
Kng1 A G 16: 23,078,980 M377V probably benign Het
Krt72 C T 15: 101,786,005 probably null Het
Lemd2 G C 17: 27,190,732 R482G probably damaging Het
Lrpprc C T 17: 84,726,303 D1049N possibly damaging Het
Lrrc49 A T 9: 60,680,527 H117Q probably damaging Het
Mcm6 A T 1: 128,351,476 F191Y probably damaging Het
Mecom T C 3: 29,979,800 T252A possibly damaging Het
Mgat4e T C 1: 134,541,533 T258A probably benign Het
Mpeg1 A G 19: 12,462,804 N542S probably damaging Het
Nln C T 13: 104,061,753 V184I probably benign Het
Nova1 A C 12: 46,816,893 F91L unknown Het
Polk T C 13: 96,484,208 I516V probably benign Het
Ppig C T 2: 69,749,018 P357S unknown Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Rasal2 A T 1: 157,164,666 H552Q probably damaging Het
Rnf41 G A 10: 128,435,571 E117K probably benign Het
Sbk3 A G 7: 4,967,453 Y306H possibly damaging Het
Senp1 A G 15: 98,076,554 S126P probably benign Het
Sfr1 A G 19: 47,733,690 K182E probably benign Het
Slc25a4 C A 8: 46,209,288 R111L probably damaging Het
Slc9c1 A T 16: 45,573,347 Y551F probably benign Het
Stard4 A T 18: 33,206,210 N80K probably damaging Het
Tbk1 G A 10: 121,571,916 T104M probably damaging Het
Tedc2 T A 17: 24,216,317 E366V probably damaging Het
Tedc2 C A 17: 24,216,318 E366* probably null Het
Tmem102 A T 11: 69,804,370 W259R probably damaging Het
Tnk1 A T 11: 69,853,136 C466S probably benign Het
Tspoap1 A C 11: 87,766,120 Q307P probably damaging Het
Ugt2b35 A G 5: 87,011,530 N528D possibly damaging Het
Usp6nl A G 2: 6,426,998 probably null Het
Vmn1r203 C T 13: 22,524,508 T153M probably benign Het
Vmn1r89 T A 7: 13,220,011 S157T probably damaging Het
Vmn2r103 A T 17: 19,792,968 Y117F probably benign Het
Vmn2r116 A C 17: 23,386,141 M143L probably benign Het
Vmn2r62 A T 7: 42,764,837 D727E probably damaging Het
Vps13c A G 9: 67,955,022 I2974V probably benign Het
Wrn C T 8: 33,268,819 G769D probably damaging Het
Zhx3 T A 2: 160,781,020 H409L possibly damaging Het
Other mutations in Clstn2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00562:Clstn2 APN 9 97582452 splice site probably benign
IGL00563:Clstn2 APN 9 97582452 splice site probably benign
IGL00733:Clstn2 APN 9 97483049 missense probably damaging 1.00
IGL01303:Clstn2 APN 9 97483075 nonsense probably null
IGL01935:Clstn2 APN 9 97463468 missense probably damaging 1.00
IGL02157:Clstn2 APN 9 97541875 missense probably benign
IGL02974:Clstn2 APN 9 97532707 missense probably damaging 1.00
IGL03164:Clstn2 APN 9 97799409 missense possibly damaging 0.50
IGL03298:Clstn2 APN 9 97456572 missense probably damaging 1.00
R0653:Clstn2 UTSW 9 97458204 missense probably damaging 1.00
R0845:Clstn2 UTSW 9 97570628 missense probably benign 0.39
R0992:Clstn2 UTSW 9 97445712 missense probably benign 0.00
R1105:Clstn2 UTSW 9 97583499 splice site probably null
R1112:Clstn2 UTSW 9 97458228 missense possibly damaging 0.92
R1264:Clstn2 UTSW 9 97457609 missense probably benign 0.28
R1275:Clstn2 UTSW 9 97457430 missense probably benign 0.00
R1329:Clstn2 UTSW 9 97458174 missense probably damaging 1.00
R1556:Clstn2 UTSW 9 97456505 missense probably benign 0.41
R1703:Clstn2 UTSW 9 97458237 missense possibly damaging 0.90
R1837:Clstn2 UTSW 9 97583540 missense probably benign 0.00
R2911:Clstn2 UTSW 9 97532722 missense probably damaging 1.00
R3434:Clstn2 UTSW 9 97454715 missense probably benign 0.17
R3771:Clstn2 UTSW 9 97582562 missense probably damaging 1.00
R3772:Clstn2 UTSW 9 97582562 missense probably damaging 1.00
R3854:Clstn2 UTSW 9 97463595 nonsense probably null
R4049:Clstn2 UTSW 9 97457560 missense possibly damaging 0.59
R4334:Clstn2 UTSW 9 97463528 missense probably damaging 1.00
R4705:Clstn2 UTSW 9 97463559 missense possibly damaging 0.95
R4755:Clstn2 UTSW 9 97445673 missense probably benign 0.01
R4884:Clstn2 UTSW 9 97799395 missense probably damaging 1.00
R5017:Clstn2 UTSW 9 97483086 missense probably damaging 1.00
R5076:Clstn2 UTSW 9 97483079 missense probably damaging 1.00
R5122:Clstn2 UTSW 9 97461421 missense probably damaging 1.00
R5155:Clstn2 UTSW 9 97456431 missense probably benign 0.02
R5560:Clstn2 UTSW 9 97469819 missense possibly damaging 0.95
R6009:Clstn2 UTSW 9 97456526 missense probably benign 0.05
R6011:Clstn2 UTSW 9 97456526 missense probably benign 0.05
R6029:Clstn2 UTSW 9 97456581 missense probably benign 0.00
R6093:Clstn2 UTSW 9 97458210 missense probably damaging 1.00
R6284:Clstn2 UTSW 9 97454674 missense probably benign
R6676:Clstn2 UTSW 9 97461531 missense probably damaging 1.00
R6902:Clstn2 UTSW 9 97469822 missense probably damaging 1.00
R6946:Clstn2 UTSW 9 97469822 missense probably damaging 1.00
R6966:Clstn2 UTSW 9 97526406 nonsense probably null
R7329:Clstn2 UTSW 9 97461369 missense probably benign 0.00
R7330:Clstn2 UTSW 9 97461369 missense probably benign 0.00
R7382:Clstn2 UTSW 9 97799398 nonsense probably null
R7410:Clstn2 UTSW 9 97541867 missense probably benign 0.06
R7549:Clstn2 UTSW 9 97582544 missense probably benign 0.01
R7879:Clstn2 UTSW 9 97469764 missense possibly damaging 0.90
R7962:Clstn2 UTSW 9 97469764 missense possibly damaging 0.90
R8070:Clstn2 UTSW 9 97799470 missense possibly damaging 0.79
R8193:Clstn2 UTSW 9 97583630 missense probably damaging 1.00
X0027:Clstn2 UTSW 9 97526399 missense probably damaging 1.00
Z1177:Clstn2 UTSW 9 97461356 missense probably benign
Predicted Primers PCR Primer
(F):5'- TGCCACACAGCACAGTGTCATC -3'
(R):5'- AACAGTTGGGACACCTGGCAAG -3'

Sequencing Primer
(F):5'- ACTAACATGGGTGTCTTACACTTGG -3'
(R):5'- TGGAGTGGCAGTCCCTTAC -3'
Posted On2014-03-17