Mutagenetix > Incidental Mutations

Incidental Mutation 'R1396:Clstn2'

162652

Institutional Source

Beutler Lab

Gene Symbol

Clstn2

Ensembl Gene

ENSMUSG00000032452

Gene Name

calsyntenin 2

Synonyms

Cst-2, CSTN2, CS2, 2900042C18Rik

MMRRC Submission

039458-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1396 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

97444395-98033181 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 97461393 bp

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 667 (V667A)

Ref Sequence

ENSEMBL: ENSMUSP00000124081 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000035027] [ENSMUST00000162295]

Predicted Effect

probably benign
Transcript: ENSMUST00000035027
AA Change: V667A

PolyPhen 2 Score 0.021 (Sensitivity: 0.95; Specificity: 0.80)

SMART Domains

Protein: ENSMUSP00000035027
Gene: ENSMUSG00000032452
AA Change: V667A

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
CA	67	160	2e-10	SMART
CA	183	261	1.18e-3	SMART
SCOP:d1a8d_1	358	538	5e-21	SMART
Blast:LamG	380	529	3e-41	BLAST
transmembrane domain	835	857	N/A	INTRINSIC
low complexity region	901	935	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000162295
AA Change: V667A

PolyPhen 2 Score 0.021 (Sensitivity: 0.95; Specificity: 0.80)

SMART Domains

Protein: ENSMUSP00000124081
Gene: ENSMUSG00000032452
AA Change: V667A

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
CA	67	160	2e-10	SMART
CA	183	261	1.18e-3	SMART
Pfam:Laminin_G_3	356	533	1.4e-9	PFAM
transmembrane domain	835	857	N/A	INTRINSIC
low complexity region	901	935	N/A	INTRINSIC

Coding Region Coverage

1x: 98.9%
3x: 98.0%
10x: 95.3%
20x: 89.4%

Validation Efficiency

MGI Phenotype

PHENOTYPE: Homozygous KO mice display deficiency in spatial learning and memory in Morris water and Barnes maze tasks and increased locomotor activity in open field test. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 57 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4921530L21Rik	A	G	14: 95,882,551	N248S	probably benign	Het
4930486L24Rik	G	A	13: 60,853,243	P160S	probably benign	Het
Adamts12	G	T	15: 11,311,472	D1272Y	probably benign	Het
Akr1c20	A	T	13: 4,507,727	V267D	probably damaging	Het
C1s1	A	G	6: 124,531,051	S660P	probably damaging	Het
Ccdc40	A	G	11: 119,231,803	T144A	possibly damaging	Het
Cdk20	T	C	13: 64,437,403	I167T	probably damaging	Het
Chd6	A	G	2: 160,983,103	L1212S	probably damaging	Het
Clock	G	C	5: 76,266,802	D15E	probably benign	Het
Cr2	A	T	1: 195,169,253		probably null	Het
Cyp2e1	A	G	7: 140,773,079	D343G	probably damaging	Het
Dync1h1	G	A	12: 110,636,509	E2195K	probably benign	Het
Etf1	G	A	18: 34,908,167	T298I	possibly damaging	Het
Gm5431	T	C	11: 48,895,434		probably benign	Het
Gss	G	A	2: 155,567,721	T265I	probably damaging	Het
Heatr1	C	T	13: 12,406,046	S406L	possibly damaging	Het
Hgsnat	C	A	8: 25,957,335	M310I	possibly damaging	Het
Inpp5b	G	A	4: 124,789,080	R598H	probably damaging	Het
Ints2	G	T	11: 86,249,248	Q253K	probably damaging	Het
Kng1	A	G	16: 23,078,980	M377V	probably benign	Het
Krt72	C	T	15: 101,786,005		probably null	Het
Lemd2	G	C	17: 27,190,732	R482G	probably damaging	Het
Lrpprc	C	T	17: 84,726,303	D1049N	possibly damaging	Het
Lrrc49	A	T	9: 60,680,527	H117Q	probably damaging	Het
Mcm6	A	T	1: 128,351,476	F191Y	probably damaging	Het
Mecom	T	C	3: 29,979,800	T252A	possibly damaging	Het
Mgat4e	T	C	1: 134,541,533	T258A	probably benign	Het
Mpeg1	A	G	19: 12,462,804	N542S	probably damaging	Het
Nln	C	T	13: 104,061,753	V184I	probably benign	Het
Nova1	A	C	12: 46,816,893	F91L	unknown	Het
Polk	T	C	13: 96,484,208	I516V	probably benign	Het
Ppig	C	T	2: 69,749,018	P357S	unknown	Het
Ptpro	T	A	6: 137,443,594	V1007D	probably damaging	Het
Rasal2	A	T	1: 157,164,666	H552Q	probably damaging	Het
Rnf41	G	A	10: 128,435,571	E117K	probably benign	Het
Sbk3	A	G	7: 4,967,453	Y306H	possibly damaging	Het
Senp1	A	G	15: 98,076,554	S126P	probably benign	Het
Sfr1	A	G	19: 47,733,690	K182E	probably benign	Het
Slc25a4	C	A	8: 46,209,288	R111L	probably damaging	Het
Slc9c1	A	T	16: 45,573,347	Y551F	probably benign	Het
Stard4	A	T	18: 33,206,210	N80K	probably damaging	Het
Tbk1	G	A	10: 121,571,916	T104M	probably damaging	Het
Tedc2	T	A	17: 24,216,317	E366V	probably damaging	Het
Tedc2	C	A	17: 24,216,318	E366*	probably null	Het
Tmem102	A	T	11: 69,804,370	W259R	probably damaging	Het
Tnk1	A	T	11: 69,853,136	C466S	probably benign	Het
Tspoap1	A	C	11: 87,766,120	Q307P	probably damaging	Het
Ugt2b35	A	G	5: 87,011,530	N528D	possibly damaging	Het
Usp6nl	A	G	2: 6,426,998		probably null	Het
Vmn1r203	C	T	13: 22,524,508	T153M	probably benign	Het
Vmn1r89	T	A	7: 13,220,011	S157T	probably damaging	Het
Vmn2r103	A	T	17: 19,792,968	Y117F	probably benign	Het
Vmn2r116	A	C	17: 23,386,141	M143L	probably benign	Het
Vmn2r62	A	T	7: 42,764,837	D727E	probably damaging	Het
Vps13c	A	G	9: 67,955,022	I2974V	probably benign	Het
Wrn	C	T	8: 33,268,819	G769D	probably damaging	Het
Zhx3	T	A	2: 160,781,020	H409L	possibly damaging	Het

Other mutations in Clstn2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00562:Clstn2	APN	9	97582452	splice site	probably benign
IGL00563:Clstn2	APN	9	97582452	splice site	probably benign
IGL00733:Clstn2	APN	9	97483049	missense	probably damaging	1.00
IGL01303:Clstn2	APN	9	97483075	nonsense	probably null
IGL01935:Clstn2	APN	9	97463468	missense	probably damaging	1.00
IGL02157:Clstn2	APN	9	97541875	missense	probably benign
IGL02974:Clstn2	APN	9	97532707	missense	probably damaging	1.00
IGL03164:Clstn2	APN	9	97799409	missense	possibly damaging	0.50
IGL03298:Clstn2	APN	9	97456572	missense	probably damaging	1.00
R0653:Clstn2	UTSW	9	97458204	missense	probably damaging	1.00
R0845:Clstn2	UTSW	9	97570628	missense	probably benign	0.39
R0992:Clstn2	UTSW	9	97445712	missense	probably benign	0.00
R1105:Clstn2	UTSW	9	97583499	splice site	probably null
R1112:Clstn2	UTSW	9	97458228	missense	possibly damaging	0.92
R1264:Clstn2	UTSW	9	97457609	missense	probably benign	0.28
R1275:Clstn2	UTSW	9	97457430	missense	probably benign	0.00
R1329:Clstn2	UTSW	9	97458174	missense	probably damaging	1.00
R1556:Clstn2	UTSW	9	97456505	missense	probably benign	0.41
R1703:Clstn2	UTSW	9	97458237	missense	possibly damaging	0.90
R1837:Clstn2	UTSW	9	97583540	missense	probably benign	0.00
R2911:Clstn2	UTSW	9	97532722	missense	probably damaging	1.00
R3434:Clstn2	UTSW	9	97454715	missense	probably benign	0.17
R3771:Clstn2	UTSW	9	97582562	missense	probably damaging	1.00
R3772:Clstn2	UTSW	9	97582562	missense	probably damaging	1.00
R3854:Clstn2	UTSW	9	97463595	nonsense	probably null
R4049:Clstn2	UTSW	9	97457560	missense	possibly damaging	0.59
R4334:Clstn2	UTSW	9	97463528	missense	probably damaging	1.00
R4705:Clstn2	UTSW	9	97463559	missense	possibly damaging	0.95
R4755:Clstn2	UTSW	9	97445673	missense	probably benign	0.01
R4884:Clstn2	UTSW	9	97799395	missense	probably damaging	1.00
R5017:Clstn2	UTSW	9	97483086	missense	probably damaging	1.00
R5076:Clstn2	UTSW	9	97483079	missense	probably damaging	1.00
R5122:Clstn2	UTSW	9	97461421	missense	probably damaging	1.00
R5155:Clstn2	UTSW	9	97456431	missense	probably benign	0.02
R5560:Clstn2	UTSW	9	97469819	missense	possibly damaging	0.95
R6009:Clstn2	UTSW	9	97456526	missense	probably benign	0.05
R6011:Clstn2	UTSW	9	97456526	missense	probably benign	0.05
R6029:Clstn2	UTSW	9	97456581	missense	probably benign	0.00
R6093:Clstn2	UTSW	9	97458210	missense	probably damaging	1.00
R6284:Clstn2	UTSW	9	97454674	missense	probably benign
R6676:Clstn2	UTSW	9	97461531	missense	probably damaging	1.00
R6902:Clstn2	UTSW	9	97469822	missense	probably damaging	1.00
R6946:Clstn2	UTSW	9	97469822	missense	probably damaging	1.00
R6966:Clstn2	UTSW	9	97526406	nonsense	probably null
R7329:Clstn2	UTSW	9	97461369	missense	probably benign	0.00
R7330:Clstn2	UTSW	9	97461369	missense	probably benign	0.00
R7382:Clstn2	UTSW	9	97799398	nonsense	probably null
R7410:Clstn2	UTSW	9	97541867	missense	probably benign	0.06
R7549:Clstn2	UTSW	9	97582544	missense	probably benign	0.01
R7879:Clstn2	UTSW	9	97469764	missense	possibly damaging	0.90
R7962:Clstn2	UTSW	9	97469764	missense	possibly damaging	0.90
R8070:Clstn2	UTSW	9	97799470	missense	possibly damaging	0.79
R8193:Clstn2	UTSW	9	97583630	missense	probably damaging	1.00
X0027:Clstn2	UTSW	9	97526399	missense	probably damaging	1.00
Z1177:Clstn2	UTSW	9	97461356	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- TGCCACACAGCACAGTGTCATC -3'
(R):5'- AACAGTTGGGACACCTGGCAAG -3'

Sequencing Primer
(F):5'- ACTAACATGGGTGTCTTACACTTGG -3'
(R):5'- TGGAGTGGCAGTCCCTTAC -3'

Posted On

2014-03-17