Incidental Mutation 'R1396:Tbk1'
ID162653
Institutional Source Beutler Lab
Gene Symbol Tbk1
Ensembl Gene ENSMUSG00000020115
Gene NameTANK-binding kinase 1
Synonyms1200008B05Rik
MMRRC Submission 039458-MU
Accession Numbers

MGI: 1929658

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1396 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location121546455-121586787 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 121571916 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Methionine at position 104 (T104M)
Ref Sequence ENSEMBL: ENSMUSP00000151935 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020316] [ENSMUST00000219400] [ENSMUST00000219493]
Predicted Effect probably damaging
Transcript: ENSMUST00000020316
AA Change: T156M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000020316
Gene: ENSMUSG00000020115
AA Change: T156M

DomainStartEndE-ValueType
Pfam:Pkinase 9 300 2.6e-46 PFAM
Pfam:Pkinase_Tyr 10 250 1.5e-27 PFAM
low complexity region 355 366 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219244
Predicted Effect probably benign
Transcript: ENSMUST00000219400
Predicted Effect probably damaging
Transcript: ENSMUST00000219493
AA Change: T104M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.3%
  • 20x: 89.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The NF-kappa-B (NFKB) complex of proteins is inhibited by I-kappa-B (IKB) proteins, which inactivate NFKB by trapping it in the cytoplasm. Phosphorylation of serine residues on the IKB proteins by IKB kinases marks them for destruction via the ubiquitination pathway, thereby allowing activation and nuclear translocation of the NFKB complex. The protein encoded by this gene is similar to IKB kinases and can mediate NFKB activation in response to certain growth factors. [provided by RefSeq, Oct 2010]
PHENOTYPE: Homozygous null mice display embryonic lethality. Mice homozygous for a different knock-out allele exhibit increased prenatal lethality, increased infiltration of mononuclear and/or granulomatous cells in multiple organs and tissues at 3 months of age, and increased lethality in response to LPS. [provided by MGI curators]
Allele List at MGI

All alleles(23) : Targeted(5) Gene trapped(18)

Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921530L21Rik A G 14: 95,882,551 N248S probably benign Het
4930486L24Rik G A 13: 60,853,243 P160S probably benign Het
Adamts12 G T 15: 11,311,472 D1272Y probably benign Het
Akr1c20 A T 13: 4,507,727 V267D probably damaging Het
C1s1 A G 6: 124,531,051 S660P probably damaging Het
Ccdc40 A G 11: 119,231,803 T144A possibly damaging Het
Cdk20 T C 13: 64,437,403 I167T probably damaging Het
Chd6 A G 2: 160,983,103 L1212S probably damaging Het
Clock G C 5: 76,266,802 D15E probably benign Het
Clstn2 A G 9: 97,461,393 V667A probably benign Het
Cr2 A T 1: 195,169,253 probably null Het
Cyp2e1 A G 7: 140,773,079 D343G probably damaging Het
Dync1h1 G A 12: 110,636,509 E2195K probably benign Het
Etf1 G A 18: 34,908,167 T298I possibly damaging Het
Gm5431 T C 11: 48,895,434 probably benign Het
Gss G A 2: 155,567,721 T265I probably damaging Het
Heatr1 C T 13: 12,406,046 S406L possibly damaging Het
Hgsnat C A 8: 25,957,335 M310I possibly damaging Het
Inpp5b G A 4: 124,789,080 R598H probably damaging Het
Ints2 G T 11: 86,249,248 Q253K probably damaging Het
Kng1 A G 16: 23,078,980 M377V probably benign Het
Krt72 C T 15: 101,786,005 probably null Het
Lemd2 G C 17: 27,190,732 R482G probably damaging Het
Lrpprc C T 17: 84,726,303 D1049N possibly damaging Het
Lrrc49 A T 9: 60,680,527 H117Q probably damaging Het
Mcm6 A T 1: 128,351,476 F191Y probably damaging Het
Mecom T C 3: 29,979,800 T252A possibly damaging Het
Mgat4e T C 1: 134,541,533 T258A probably benign Het
Mpeg1 A G 19: 12,462,804 N542S probably damaging Het
Nln C T 13: 104,061,753 V184I probably benign Het
Nova1 A C 12: 46,816,893 F91L unknown Het
Polk T C 13: 96,484,208 I516V probably benign Het
Ppig C T 2: 69,749,018 P357S unknown Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Rasal2 A T 1: 157,164,666 H552Q probably damaging Het
Rnf41 G A 10: 128,435,571 E117K probably benign Het
Sbk3 A G 7: 4,967,453 Y306H possibly damaging Het
Senp1 A G 15: 98,076,554 S126P probably benign Het
Sfr1 A G 19: 47,733,690 K182E probably benign Het
Slc25a4 C A 8: 46,209,288 R111L probably damaging Het
Slc9c1 A T 16: 45,573,347 Y551F probably benign Het
Stard4 A T 18: 33,206,210 N80K probably damaging Het
Tedc2 T A 17: 24,216,317 E366V probably damaging Het
Tedc2 C A 17: 24,216,318 E366* probably null Het
Tmem102 A T 11: 69,804,370 W259R probably damaging Het
Tnk1 A T 11: 69,853,136 C466S probably benign Het
Tspoap1 A C 11: 87,766,120 Q307P probably damaging Het
Ugt2b35 A G 5: 87,011,530 N528D possibly damaging Het
Usp6nl A G 2: 6,426,998 probably null Het
Vmn1r203 C T 13: 22,524,508 T153M probably benign Het
Vmn1r89 T A 7: 13,220,011 S157T probably damaging Het
Vmn2r103 A T 17: 19,792,968 Y117F probably benign Het
Vmn2r116 A C 17: 23,386,141 M143L probably benign Het
Vmn2r62 A T 7: 42,764,837 D727E probably damaging Het
Vps13c A G 9: 67,955,022 I2974V probably benign Het
Wrn C T 8: 33,268,819 G769D probably damaging Het
Zhx3 T A 2: 160,781,020 H409L possibly damaging Het
Other mutations in Tbk1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00514:Tbk1 APN 10 121552250 missense probably benign 0.00
IGL01021:Tbk1 APN 10 121551272 missense probably benign 0.07
IGL01371:Tbk1 APN 10 121559871 missense probably benign 0.09
IGL01383:Tbk1 APN 10 121576279 missense probably damaging 1.00
IGL01583:Tbk1 APN 10 121557229 missense probably benign
IGL01734:Tbk1 APN 10 121571983 nonsense probably null
IGL02068:Tbk1 APN 10 121570789 missense probably damaging 1.00
IGL02676:Tbk1 APN 10 121568080 missense possibly damaging 0.82
IGL02737:Tbk1 APN 10 121559862 missense probably null 0.96
IGL03334:Tbk1 APN 10 121584199 missense possibly damaging 0.79
Pathfinder UTSW 10 121552501 missense probably damaging 0.98
pioneer UTSW 10 121578690 missense probably damaging 1.00
trailblazer UTSW 10 121570685 missense probably damaging 1.00
BB006:Tbk1 UTSW 10 121557233 missense probably benign 0.00
BB016:Tbk1 UTSW 10 121557233 missense probably benign 0.00
R0030:Tbk1 UTSW 10 121561624 missense probably benign 0.09
R0386:Tbk1 UTSW 10 121584254 missense probably damaging 0.96
R1430:Tbk1 UTSW 10 121559934 missense probably benign
R1522:Tbk1 UTSW 10 121551318 missense probably benign 0.06
R1542:Tbk1 UTSW 10 121559935 missense probably benign
R1717:Tbk1 UTSW 10 121561645 missense probably benign 0.10
R1860:Tbk1 UTSW 10 121547171 missense probably benign 0.01
R2188:Tbk1 UTSW 10 121563931 nonsense probably null
R2519:Tbk1 UTSW 10 121557259 missense probably benign 0.03
R4627:Tbk1 UTSW 10 121568080 missense possibly damaging 0.82
R4945:Tbk1 UTSW 10 121551269 missense probably damaging 0.98
R5061:Tbk1 UTSW 10 121576336 missense possibly damaging 0.62
R5256:Tbk1 UTSW 10 121570685 missense probably damaging 1.00
R5310:Tbk1 UTSW 10 121556051 missense probably benign 0.00
R6187:Tbk1 UTSW 10 121584243 missense probably benign 0.02
R6425:Tbk1 UTSW 10 121563962 missense probably benign 0.00
R6512:Tbk1 UTSW 10 121578621 missense probably damaging 1.00
R6897:Tbk1 UTSW 10 121559877 missense probably benign 0.00
R7268:Tbk1 UTSW 10 121552499 missense probably benign 0.03
R7609:Tbk1 UTSW 10 121552501 missense probably damaging 0.98
R7860:Tbk1 UTSW 10 121552246 missense possibly damaging 0.55
R7929:Tbk1 UTSW 10 121557233 missense probably benign 0.00
R8378:Tbk1 UTSW 10 121578692 missense probably damaging 0.96
X0022:Tbk1 UTSW 10 121560293 missense probably benign
Predicted Primers PCR Primer
(F):5'- CTGAGCCTGCCCAATAGAAAGTGAC -3'
(R):5'- GTCCTGTCCATGAGTTTGAGACGC -3'

Sequencing Primer
(F):5'- CTTATTACGCAACATATCCATCGG -3'
(R):5'- CGCGTATACAAACGGAGGC -3'
Posted On2014-03-17