Incidental Mutation 'R1396:Gm5431'
Institutional Source Beutler Lab
Gene Symbol Gm5431
Ensembl Gene ENSMUSG00000058163
Gene Namepredicted gene 5431
MMRRC Submission 039458-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.062) question?
Stock #R1396 (G1)
Quality Score225
Status Not validated
Chromosomal Location48887422-48902214 bp(-) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) T to C at 48895434 bp
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000104833 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000109209] [ENSMUST00000109210] [ENSMUST00000109212]
Predicted Effect probably benign
Transcript: ENSMUST00000109209
SMART Domains Protein: ENSMUSP00000104832
Gene: ENSMUSG00000058163

Pfam:IIGP 1 120 1.6e-22 PFAM
low complexity region 153 166 N/A INTRINSIC
Pfam:IIGP 169 542 9.4e-154 PFAM
Pfam:MMR_HSR1 205 359 1.5e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000109210
SMART Domains Protein: ENSMUSP00000104833
Gene: ENSMUSG00000058163

Pfam:IIGP 1 120 1.6e-22 PFAM
low complexity region 153 166 N/A INTRINSIC
Pfam:IIGP 169 542 9.4e-154 PFAM
Pfam:MMR_HSR1 205 359 1.5e-7 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000109212
AA Change: E38G
SMART Domains Protein: ENSMUSP00000104835
Gene: ENSMUSG00000058163
AA Change: E38G

Pfam:IIGP 36 398 2.5e-125 PFAM
Pfam:DLIC 54 107 3.4e-5 PFAM
Pfam:MMR_HSR1 72 235 1.7e-11 PFAM
low complexity region 431 444 N/A INTRINSIC
Pfam:IIGP 447 820 6.3e-153 PFAM
Pfam:MMR_HSR1 483 606 2.4e-7 PFAM
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.3%
  • 20x: 89.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921530L21Rik A G 14: 95,882,551 N248S probably benign Het
4930486L24Rik G A 13: 60,853,243 P160S probably benign Het
Adamts12 G T 15: 11,311,472 D1272Y probably benign Het
Akr1c20 A T 13: 4,507,727 V267D probably damaging Het
C1s1 A G 6: 124,531,051 S660P probably damaging Het
Ccdc40 A G 11: 119,231,803 T144A possibly damaging Het
Cdk20 T C 13: 64,437,403 I167T probably damaging Het
Chd6 A G 2: 160,983,103 L1212S probably damaging Het
Clock G C 5: 76,266,802 D15E probably benign Het
Clstn2 A G 9: 97,461,393 V667A probably benign Het
Cr2 A T 1: 195,169,253 probably null Het
Cyp2e1 A G 7: 140,773,079 D343G probably damaging Het
Dync1h1 G A 12: 110,636,509 E2195K probably benign Het
Etf1 G A 18: 34,908,167 T298I possibly damaging Het
Gss G A 2: 155,567,721 T265I probably damaging Het
Heatr1 C T 13: 12,406,046 S406L possibly damaging Het
Hgsnat C A 8: 25,957,335 M310I possibly damaging Het
Inpp5b G A 4: 124,789,080 R598H probably damaging Het
Ints2 G T 11: 86,249,248 Q253K probably damaging Het
Kng1 A G 16: 23,078,980 M377V probably benign Het
Krt72 C T 15: 101,786,005 probably null Het
Lemd2 G C 17: 27,190,732 R482G probably damaging Het
Lrpprc C T 17: 84,726,303 D1049N possibly damaging Het
Lrrc49 A T 9: 60,680,527 H117Q probably damaging Het
Mcm6 A T 1: 128,351,476 F191Y probably damaging Het
Mecom T C 3: 29,979,800 T252A possibly damaging Het
Mgat4e T C 1: 134,541,533 T258A probably benign Het
Mpeg1 A G 19: 12,462,804 N542S probably damaging Het
Nln C T 13: 104,061,753 V184I probably benign Het
Nova1 A C 12: 46,816,893 F91L unknown Het
Polk T C 13: 96,484,208 I516V probably benign Het
Ppig C T 2: 69,749,018 P357S unknown Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Rasal2 A T 1: 157,164,666 H552Q probably damaging Het
Rnf41 G A 10: 128,435,571 E117K probably benign Het
Sbk3 A G 7: 4,967,453 Y306H possibly damaging Het
Senp1 A G 15: 98,076,554 S126P probably benign Het
Sfr1 A G 19: 47,733,690 K182E probably benign Het
Slc25a4 C A 8: 46,209,288 R111L probably damaging Het
Slc9c1 A T 16: 45,573,347 Y551F probably benign Het
Stard4 A T 18: 33,206,210 N80K probably damaging Het
Tbk1 G A 10: 121,571,916 T104M probably damaging Het
Tedc2 C A 17: 24,216,318 E366* probably null Het
Tedc2 T A 17: 24,216,317 E366V probably damaging Het
Tmem102 A T 11: 69,804,370 W259R probably damaging Het
Tnk1 A T 11: 69,853,136 C466S probably benign Het
Tspoap1 A C 11: 87,766,120 Q307P probably damaging Het
Ugt2b35 A G 5: 87,011,530 N528D possibly damaging Het
Usp6nl A G 2: 6,426,998 probably null Het
Vmn1r203 C T 13: 22,524,508 T153M probably benign Het
Vmn1r89 T A 7: 13,220,011 S157T probably damaging Het
Vmn2r103 A T 17: 19,792,968 Y117F probably benign Het
Vmn2r116 A C 17: 23,386,141 M143L probably benign Het
Vmn2r62 A T 7: 42,764,837 D727E probably damaging Het
Vps13c A G 9: 67,955,022 I2974V probably benign Het
Wrn C T 8: 33,268,819 G769D probably damaging Het
Zhx3 T A 2: 160,781,020 H409L possibly damaging Het
Other mutations in Gm5431
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00479:Gm5431 APN 11 48895414 missense probably benign 0.09
IGL00964:Gm5431 APN 11 48889267 missense probably damaging 0.99
IGL01571:Gm5431 APN 11 48894713 missense probably benign 0.00
IGL02006:Gm5431 APN 11 48888503 missense probably damaging 1.00
IGL02084:Gm5431 APN 11 48889085 missense probably benign 0.41
IGL02255:Gm5431 APN 11 48888958 missense possibly damaging 0.93
IGL02291:Gm5431 APN 11 48888964 missense probably damaging 1.00
IGL03194:Gm5431 APN 11 48895537 intron probably benign
IGL03251:Gm5431 APN 11 48894721 missense probably benign 0.00
R1168:Gm5431 UTSW 11 48895364 missense probably benign 0.36
R1387:Gm5431 UTSW 11 48895015 missense possibly damaging 0.92
R1711:Gm5431 UTSW 11 48895026 missense possibly damaging 0.73
R1750:Gm5431 UTSW 11 48894831 missense probably benign 0.01
R1927:Gm5431 UTSW 11 48889255 missense probably damaging 1.00
R1957:Gm5431 UTSW 11 48888397 nonsense probably null
R2196:Gm5431 UTSW 11 48889231 missense probably damaging 1.00
R2509:Gm5431 UTSW 11 48888709 missense probably benign 0.16
R2511:Gm5431 UTSW 11 48888709 missense probably benign 0.16
R4018:Gm5431 UTSW 11 48889168 missense probably damaging 1.00
R4859:Gm5431 UTSW 11 48889582 missense probably damaging 1.00
R4895:Gm5431 UTSW 11 48889028 missense probably damaging 0.98
R5124:Gm5431 UTSW 11 48889039 missense probably benign 0.31
R5311:Gm5431 UTSW 11 48888889 missense probably damaging 1.00
R5600:Gm5431 UTSW 11 48894756 missense possibly damaging 0.56
R5728:Gm5431 UTSW 11 48888613 missense probably damaging 1.00
R5731:Gm5431 UTSW 11 48894448 missense probably damaging 0.96
R6120:Gm5431 UTSW 11 48894781 missense probably benign 0.36
R6129:Gm5431 UTSW 11 48889591 missense probably damaging 1.00
R6169:Gm5431 UTSW 11 48888575 missense probably benign 0.29
R6192:Gm5431 UTSW 11 48894393 missense probably benign 0.01
R6253:Gm5431 UTSW 11 48894999 missense probably benign 0.00
R6326:Gm5431 UTSW 11 48889345 missense probably damaging 1.00
R6401:Gm5431 UTSW 11 48888709 missense probably benign 0.16
R6654:Gm5431 UTSW 11 48894600 missense possibly damaging 0.91
R6810:Gm5431 UTSW 11 48888976 missense probably damaging 1.00
R6965:Gm5431 UTSW 11 48895200 missense probably benign 0.19
R6970:Gm5431 UTSW 11 48888490 missense probably damaging 1.00
R7269:Gm5431 UTSW 11 48888410 missense probably benign
R7770:Gm5431 UTSW 11 48888458 missense probably benign 0.02
R8260:Gm5431 UTSW 11 48894729 missense probably benign 0.01
R8385:Gm5431 UTSW 11 48889520 missense probably damaging 1.00
Predicted Primers PCR Primer

Sequencing Primer
(R):5'- cctccttagtgctgcgattac -3'
Posted On2014-03-17