Incidental Mutation 'R1396:Tnk1'
ID162657
Institutional Source Beutler Lab
Gene Symbol Tnk1
Ensembl Gene ENSMUSG00000001583
Gene Nametyrosine kinase, non-receptor, 1
SynonymsTnk1a, Kos1, Tnk1b
MMRRC Submission 039458-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1396 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location69851005-69858730 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 69853136 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Serine at position 466 (C466S)
Ref Sequence ENSEMBL: ENSMUSP00000104268 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001626] [ENSMUST00000019605] [ENSMUST00000108626] [ENSMUST00000108628] [ENSMUST00000108632] [ENSMUST00000108633] [ENSMUST00000125571] [ENSMUST00000152566] [ENSMUST00000156507]
Predicted Effect probably benign
Transcript: ENSMUST00000001626
AA Change: C461S

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000001626
Gene: ENSMUSG00000001583
AA Change: C461S

DomainStartEndE-ValueType
low complexity region 6 15 N/A INTRINSIC
Blast:TyrKc 43 80 1e-5 BLAST
TyrKc 116 378 1.2e-108 SMART
SH3 384 440 4.11e-1 SMART
low complexity region 504 517 N/A INTRINSIC
low complexity region 528 544 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000019605
SMART Domains Protein: ENSMUSP00000019605
Gene: ENSMUSG00000019461

DomainStartEndE-ValueType
low complexity region 6 28 N/A INTRINSIC
low complexity region 32 49 N/A INTRINSIC
Pfam:Scramblase 63 285 1.7e-88 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108626
SMART Domains Protein: ENSMUSP00000104266
Gene: ENSMUSG00000001583

DomainStartEndE-ValueType
low complexity region 6 15 N/A INTRINSIC
Blast:TyrKc 43 80 6e-6 BLAST
TyrKc 116 378 1.2e-108 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000108628
AA Change: C466S

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000104268
Gene: ENSMUSG00000001583
AA Change: C466S

DomainStartEndE-ValueType
low complexity region 6 15 N/A INTRINSIC
Blast:TyrKc 43 80 1e-5 BLAST
TyrKc 116 378 1.2e-108 SMART
SH3 384 445 6.1e-1 SMART
low complexity region 509 522 N/A INTRINSIC
low complexity region 533 549 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108632
SMART Domains Protein: ENSMUSP00000104272
Gene: ENSMUSG00000019461

DomainStartEndE-ValueType
low complexity region 6 28 N/A INTRINSIC
low complexity region 32 49 N/A INTRINSIC
Pfam:Scramblase 63 285 1.7e-88 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108633
SMART Domains Protein: ENSMUSP00000104273
Gene: ENSMUSG00000019461

DomainStartEndE-ValueType
low complexity region 6 28 N/A INTRINSIC
low complexity region 32 49 N/A INTRINSIC
Pfam:Scramblase 63 285 1.7e-88 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000125571
SMART Domains Protein: ENSMUSP00000118490
Gene: ENSMUSG00000001583

DomainStartEndE-ValueType
low complexity region 6 15 N/A INTRINSIC
Blast:TyrKc 43 72 2e-6 BLAST
Pfam:Pkinase 116 268 3.3e-21 PFAM
Pfam:Pkinase_Tyr 116 268 1.9e-37 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000152566
SMART Domains Protein: ENSMUSP00000123549
Gene: ENSMUSG00000019461

DomainStartEndE-ValueType
low complexity region 6 28 N/A INTRINSIC
low complexity region 32 49 N/A INTRINSIC
Pfam:Scramblase 63 224 2.1e-56 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000156507
AA Change: C84S
SMART Domains Protein: ENSMUSP00000120585
Gene: ENSMUSG00000001583
AA Change: C84S

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 1 76 8.4e-17 PFAM
Pfam:Pkinase 1 97 1.2e-6 PFAM
low complexity region 127 140 N/A INTRINSIC
low complexity region 151 167 N/A INTRINSIC
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.3%
  • 20x: 89.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the tyrosine protein kinase family. Tyrosine protein kinases are important regulators of intracellular signal transduction pathways, mediating cellular proliferation, survival, and development. This gene is highly expressed in fetal tissues and at lower levels in few adult tissues, thus may function in signaling pathways utilized broadly during fetal development, and more selectively in adult tissues. It plays a negative regulatory role in the Ras-Raf1-MAPK pathway, and knockout mice have been shown to develop spontaneous tumors, suggesting a role as a tumor suppressor gene. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2011]
PHENOTYPE: Mice either heterozygous or homozygous for a knock-out allele develop spontaneous tumors, including lymphomas and carcinomas, at high rates. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921530L21Rik A G 14: 95,882,551 N248S probably benign Het
4930486L24Rik G A 13: 60,853,243 P160S probably benign Het
Adamts12 G T 15: 11,311,472 D1272Y probably benign Het
Akr1c20 A T 13: 4,507,727 V267D probably damaging Het
C1s1 A G 6: 124,531,051 S660P probably damaging Het
Ccdc40 A G 11: 119,231,803 T144A possibly damaging Het
Cdk20 T C 13: 64,437,403 I167T probably damaging Het
Chd6 A G 2: 160,983,103 L1212S probably damaging Het
Clock G C 5: 76,266,802 D15E probably benign Het
Clstn2 A G 9: 97,461,393 V667A probably benign Het
Cr2 A T 1: 195,169,253 probably null Het
Cyp2e1 A G 7: 140,773,079 D343G probably damaging Het
Dync1h1 G A 12: 110,636,509 E2195K probably benign Het
Etf1 G A 18: 34,908,167 T298I possibly damaging Het
Gm5431 T C 11: 48,895,434 probably benign Het
Gss G A 2: 155,567,721 T265I probably damaging Het
Heatr1 C T 13: 12,406,046 S406L possibly damaging Het
Hgsnat C A 8: 25,957,335 M310I possibly damaging Het
Inpp5b G A 4: 124,789,080 R598H probably damaging Het
Ints2 G T 11: 86,249,248 Q253K probably damaging Het
Kng1 A G 16: 23,078,980 M377V probably benign Het
Krt72 C T 15: 101,786,005 probably null Het
Lemd2 G C 17: 27,190,732 R482G probably damaging Het
Lrpprc C T 17: 84,726,303 D1049N possibly damaging Het
Lrrc49 A T 9: 60,680,527 H117Q probably damaging Het
Mcm6 A T 1: 128,351,476 F191Y probably damaging Het
Mecom T C 3: 29,979,800 T252A possibly damaging Het
Mgat4e T C 1: 134,541,533 T258A probably benign Het
Mpeg1 A G 19: 12,462,804 N542S probably damaging Het
Nln C T 13: 104,061,753 V184I probably benign Het
Nova1 A C 12: 46,816,893 F91L unknown Het
Polk T C 13: 96,484,208 I516V probably benign Het
Ppig C T 2: 69,749,018 P357S unknown Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Rasal2 A T 1: 157,164,666 H552Q probably damaging Het
Rnf41 G A 10: 128,435,571 E117K probably benign Het
Sbk3 A G 7: 4,967,453 Y306H possibly damaging Het
Senp1 A G 15: 98,076,554 S126P probably benign Het
Sfr1 A G 19: 47,733,690 K182E probably benign Het
Slc25a4 C A 8: 46,209,288 R111L probably damaging Het
Slc9c1 A T 16: 45,573,347 Y551F probably benign Het
Stard4 A T 18: 33,206,210 N80K probably damaging Het
Tbk1 G A 10: 121,571,916 T104M probably damaging Het
Tedc2 T A 17: 24,216,317 E366V probably damaging Het
Tedc2 C A 17: 24,216,318 E366* probably null Het
Tmem102 A T 11: 69,804,370 W259R probably damaging Het
Tspoap1 A C 11: 87,766,120 Q307P probably damaging Het
Ugt2b35 A G 5: 87,011,530 N528D possibly damaging Het
Usp6nl A G 2: 6,426,998 probably null Het
Vmn1r203 C T 13: 22,524,508 T153M probably benign Het
Vmn1r89 T A 7: 13,220,011 S157T probably damaging Het
Vmn2r103 A T 17: 19,792,968 Y117F probably benign Het
Vmn2r116 A C 17: 23,386,141 M143L probably benign Het
Vmn2r62 A T 7: 42,764,837 D727E probably damaging Het
Vps13c A G 9: 67,955,022 I2974V probably benign Het
Wrn C T 8: 33,268,819 G769D probably damaging Het
Zhx3 T A 2: 160,781,020 H409L possibly damaging Het
Other mutations in Tnk1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01445:Tnk1 APN 11 69855905 unclassified probably benign
IGL02668:Tnk1 APN 11 69856923 missense probably damaging 1.00
R0211:Tnk1 UTSW 11 69855181 missense probably damaging 1.00
R0211:Tnk1 UTSW 11 69855181 missense probably damaging 1.00
R0389:Tnk1 UTSW 11 69855682 missense probably damaging 1.00
R0529:Tnk1 UTSW 11 69855164 missense probably damaging 1.00
R1436:Tnk1 UTSW 11 69852293 splice site probably benign
R1494:Tnk1 UTSW 11 69856546 missense possibly damaging 0.60
R1687:Tnk1 UTSW 11 69856473 missense possibly damaging 0.75
R1752:Tnk1 UTSW 11 69856706 missense possibly damaging 0.92
R1832:Tnk1 UTSW 11 69856928 missense probably damaging 0.99
R2109:Tnk1 UTSW 11 69855183 missense probably damaging 1.00
R2233:Tnk1 UTSW 11 69855191 unclassified probably null
R2234:Tnk1 UTSW 11 69855191 unclassified probably null
R2423:Tnk1 UTSW 11 69855761 missense probably damaging 0.98
R3018:Tnk1 UTSW 11 69854911 intron probably benign
R3689:Tnk1 UTSW 11 69855599 missense probably damaging 1.00
R4746:Tnk1 UTSW 11 69855166 missense probably damaging 1.00
R5653:Tnk1 UTSW 11 69853585 missense probably damaging 1.00
R6154:Tnk1 UTSW 11 69856954 missense probably damaging 1.00
R7384:Tnk1 UTSW 11 69851621 missense probably damaging 1.00
R7649:Tnk1 UTSW 11 69853577 splice site probably null
R7680:Tnk1 UTSW 11 69856745 missense possibly damaging 0.89
X0061:Tnk1 UTSW 11 69852272 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGACCCACAAGGGAAGCTCCAGATG -3'
(R):5'- TCATTGAGGGCAGGTGACAACCTTATG -3'

Sequencing Primer
(F):5'- TGCTATTTGACCAGCAGTCC -3'
(R):5'- ttgtgttggagagaaaaaggc -3'
Posted On2014-03-17