Incidental Mutation 'R1396:Ints2'
ID 162658
Institutional Source Beutler Lab
Gene Symbol Ints2
Ensembl Gene ENSMUSG00000018068
Gene Name integrator complex subunit 2
Synonyms 2810417D08Rik
MMRRC Submission 039458-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R1396 (G1)
Quality Score 225
Status Not validated
Chromosome 11
Chromosomal Location 86101507-86148401 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to T at 86140074 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamine to Lysine at position 253 (Q253K)
Ref Sequence ENSEMBL: ENSMUSP00000103674 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018212] [ENSMUST00000108039] [ENSMUST00000139285]
AlphaFold Q80UK8
Predicted Effect probably damaging
Transcript: ENSMUST00000018212
AA Change: Q253K

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000018212
Gene: ENSMUSG00000018068
AA Change: Q253K

DomainStartEndE-ValueType
Pfam:INTS2 24 1131 N/A PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000108039
AA Change: Q253K

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000103674
Gene: ENSMUSG00000018068
AA Change: Q253K

DomainStartEndE-ValueType
Pfam:INTS2 24 1132 N/A PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134883
Predicted Effect probably benign
Transcript: ENSMUST00000139285
SMART Domains Protein: ENSMUSP00000119084
Gene: ENSMUSG00000018068

DomainStartEndE-ValueType
Pfam:INTS2 24 190 1.4e-69 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143819
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.3%
  • 20x: 89.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] INTS2 is a subunit of the Integrator complex, which associates with the C-terminal domain of RNA polymerase II large subunit (POLR2A; MIM 180660) and mediates 3-prime end processing of small nuclear RNAs U1 (RNU1; MIM 180680) and U2 (RNU2; MIM 180690) (Baillat et al., 2005 [PubMed 16239144]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930486L24Rik G A 13: 61,001,057 (GRCm39) P160S probably benign Het
Adamts12 G T 15: 11,311,558 (GRCm39) D1272Y probably benign Het
Akr1c20 A T 13: 4,557,726 (GRCm39) V267D probably damaging Het
C1s1 A G 6: 124,508,010 (GRCm39) S660P probably damaging Het
Ccdc202 A G 14: 96,119,987 (GRCm39) N248S probably benign Het
Ccdc40 A G 11: 119,122,629 (GRCm39) T144A possibly damaging Het
Cdk20 T C 13: 64,585,217 (GRCm39) I167T probably damaging Het
Chd6 A G 2: 160,825,023 (GRCm39) L1212S probably damaging Het
Clock G C 5: 76,414,649 (GRCm39) D15E probably benign Het
Clstn2 A G 9: 97,343,446 (GRCm39) V667A probably benign Het
Cr2 A T 1: 194,851,561 (GRCm39) probably null Het
Cyp2e1 A G 7: 140,352,992 (GRCm39) D343G probably damaging Het
Dync1h1 G A 12: 110,602,943 (GRCm39) E2195K probably benign Het
Etf1 G A 18: 35,041,220 (GRCm39) T298I possibly damaging Het
Gm5431 T C 11: 48,786,261 (GRCm39) probably benign Het
Gss G A 2: 155,409,641 (GRCm39) T265I probably damaging Het
Heatr1 C T 13: 12,420,927 (GRCm39) S406L possibly damaging Het
Hgsnat C A 8: 26,447,363 (GRCm39) M310I possibly damaging Het
Inpp5b G A 4: 124,682,873 (GRCm39) R598H probably damaging Het
Kng1 A G 16: 22,897,730 (GRCm39) M377V probably benign Het
Krt72 C T 15: 101,694,440 (GRCm39) probably null Het
Lemd2 G C 17: 27,409,706 (GRCm39) R482G probably damaging Het
Lrpprc C T 17: 85,033,731 (GRCm39) D1049N possibly damaging Het
Lrrc49 A T 9: 60,587,810 (GRCm39) H117Q probably damaging Het
Mcm6 A T 1: 128,279,213 (GRCm39) F191Y probably damaging Het
Mecom T C 3: 30,033,949 (GRCm39) T252A possibly damaging Het
Mgat4e T C 1: 134,469,271 (GRCm39) T258A probably benign Het
Mpeg1 A G 19: 12,440,168 (GRCm39) N542S probably damaging Het
Nln C T 13: 104,198,261 (GRCm39) V184I probably benign Het
Nova1 A C 12: 46,863,676 (GRCm39) F91L unknown Het
Polk T C 13: 96,620,716 (GRCm39) I516V probably benign Het
Ppig C T 2: 69,579,362 (GRCm39) P357S unknown Het
Ptpro T A 6: 137,420,592 (GRCm39) V1007D probably damaging Het
Rasal2 A T 1: 156,992,236 (GRCm39) H552Q probably damaging Het
Rnf41 G A 10: 128,271,440 (GRCm39) E117K probably benign Het
Sbk3 A G 7: 4,970,452 (GRCm39) Y306H possibly damaging Het
Senp1 A G 15: 97,974,435 (GRCm39) S126P probably benign Het
Sfr1 A G 19: 47,722,129 (GRCm39) K182E probably benign Het
Slc25a4 C A 8: 46,662,325 (GRCm39) R111L probably damaging Het
Slc9c1 A T 16: 45,393,710 (GRCm39) Y551F probably benign Het
Stard4 A T 18: 33,339,263 (GRCm39) N80K probably damaging Het
Tbk1 G A 10: 121,407,821 (GRCm39) T104M probably damaging Het
Tedc2 C A 17: 24,435,292 (GRCm39) E366* probably null Het
Tedc2 T A 17: 24,435,291 (GRCm39) E366V probably damaging Het
Tmem102 A T 11: 69,695,196 (GRCm39) W259R probably damaging Het
Tnk1 A T 11: 69,743,962 (GRCm39) C466S probably benign Het
Tspoap1 A C 11: 87,656,946 (GRCm39) Q307P probably damaging Het
Ugt2b35 A G 5: 87,159,389 (GRCm39) N528D possibly damaging Het
Usp6nl A G 2: 6,431,809 (GRCm39) probably null Het
Vmn1r203 C T 13: 22,708,678 (GRCm39) T153M probably benign Het
Vmn1r89 T A 7: 12,953,938 (GRCm39) S157T probably damaging Het
Vmn2r103 A T 17: 20,013,230 (GRCm39) Y117F probably benign Het
Vmn2r116 A C 17: 23,605,115 (GRCm39) M143L probably benign Het
Vmn2r62 A T 7: 42,414,261 (GRCm39) D727E probably damaging Het
Vps13c A G 9: 67,862,304 (GRCm39) I2974V probably benign Het
Wrn C T 8: 33,758,847 (GRCm39) G769D probably damaging Het
Zhx3 T A 2: 160,622,940 (GRCm39) H409L possibly damaging Het
Other mutations in Ints2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00807:Ints2 APN 11 86,123,961 (GRCm39) missense probably damaging 1.00
IGL02490:Ints2 APN 11 86,124,009 (GRCm39) missense possibly damaging 0.93
IGL02612:Ints2 APN 11 86,106,404 (GRCm39) missense probably damaging 1.00
IGL03396:Ints2 APN 11 86,103,888 (GRCm39) missense probably damaging 0.99
R0015:Ints2 UTSW 11 86,140,113 (GRCm39) missense probably damaging 1.00
R0015:Ints2 UTSW 11 86,140,113 (GRCm39) missense probably damaging 1.00
R0355:Ints2 UTSW 11 86,125,575 (GRCm39) missense probably benign 0.00
R0389:Ints2 UTSW 11 86,139,677 (GRCm39) missense probably damaging 1.00
R0631:Ints2 UTSW 11 86,124,022 (GRCm39) missense probably benign 0.02
R0944:Ints2 UTSW 11 86,135,289 (GRCm39) missense possibly damaging 0.85
R1268:Ints2 UTSW 11 86,123,911 (GRCm39) missense probably damaging 1.00
R1269:Ints2 UTSW 11 86,123,911 (GRCm39) missense probably damaging 1.00
R1270:Ints2 UTSW 11 86,123,911 (GRCm39) missense probably damaging 1.00
R1474:Ints2 UTSW 11 86,117,607 (GRCm39) missense probably damaging 0.97
R1503:Ints2 UTSW 11 86,117,607 (GRCm39) missense probably damaging 0.97
R1840:Ints2 UTSW 11 86,123,911 (GRCm39) missense probably damaging 1.00
R1987:Ints2 UTSW 11 86,108,626 (GRCm39) missense probably benign 0.03
R1990:Ints2 UTSW 11 86,139,760 (GRCm39) missense possibly damaging 0.58
R1991:Ints2 UTSW 11 86,139,760 (GRCm39) missense possibly damaging 0.58
R3694:Ints2 UTSW 11 86,133,827 (GRCm39) missense probably benign 0.41
R4056:Ints2 UTSW 11 86,133,778 (GRCm39) missense probably damaging 1.00
R4057:Ints2 UTSW 11 86,133,778 (GRCm39) missense probably damaging 1.00
R4569:Ints2 UTSW 11 86,147,024 (GRCm39) missense probably damaging 1.00
R4585:Ints2 UTSW 11 86,140,101 (GRCm39) missense probably damaging 1.00
R4586:Ints2 UTSW 11 86,140,101 (GRCm39) missense probably damaging 1.00
R4806:Ints2 UTSW 11 86,147,035 (GRCm39) missense probably benign 0.10
R4929:Ints2 UTSW 11 86,103,479 (GRCm39) missense possibly damaging 0.56
R5031:Ints2 UTSW 11 86,147,026 (GRCm39) missense probably damaging 1.00
R5064:Ints2 UTSW 11 86,140,100 (GRCm39) missense probably damaging 1.00
R5270:Ints2 UTSW 11 86,106,621 (GRCm39) missense probably damaging 1.00
R5621:Ints2 UTSW 11 86,133,773 (GRCm39) missense probably benign 0.32
R5875:Ints2 UTSW 11 86,129,138 (GRCm39) missense probably benign 0.04
R5908:Ints2 UTSW 11 86,106,371 (GRCm39) critical splice donor site probably null
R5914:Ints2 UTSW 11 86,113,000 (GRCm39) missense probably benign 0.03
R5941:Ints2 UTSW 11 86,141,798 (GRCm39) missense probably benign 0.01
R5975:Ints2 UTSW 11 86,117,574 (GRCm39) missense possibly damaging 0.72
R6003:Ints2 UTSW 11 86,129,294 (GRCm39) missense probably damaging 1.00
R6091:Ints2 UTSW 11 86,127,429 (GRCm39) missense probably damaging 0.96
R6209:Ints2 UTSW 11 86,115,884 (GRCm39) missense probably damaging 1.00
R6567:Ints2 UTSW 11 86,117,487 (GRCm39) missense probably benign 0.42
R6764:Ints2 UTSW 11 86,103,605 (GRCm39) missense probably benign 0.00
R7033:Ints2 UTSW 11 86,123,911 (GRCm39) missense probably damaging 1.00
R7132:Ints2 UTSW 11 86,108,580 (GRCm39) missense probably benign 0.26
R7337:Ints2 UTSW 11 86,108,668 (GRCm39) missense probably benign 0.00
R7410:Ints2 UTSW 11 86,124,052 (GRCm39) missense probably benign 0.02
R7483:Ints2 UTSW 11 86,106,444 (GRCm39) missense probably damaging 1.00
R7503:Ints2 UTSW 11 86,122,881 (GRCm39) missense probably benign
R7804:Ints2 UTSW 11 86,103,489 (GRCm39) missense possibly damaging 0.92
R7845:Ints2 UTSW 11 86,129,089 (GRCm39) missense possibly damaging 0.93
R7875:Ints2 UTSW 11 86,103,888 (GRCm39) missense probably damaging 0.99
R7918:Ints2 UTSW 11 86,113,043 (GRCm39) missense probably damaging 1.00
R7922:Ints2 UTSW 11 86,135,453 (GRCm39) missense probably benign 0.29
R8058:Ints2 UTSW 11 86,146,179 (GRCm39) missense probably benign 0.05
R8134:Ints2 UTSW 11 86,103,486 (GRCm39) missense probably damaging 1.00
R8189:Ints2 UTSW 11 86,106,396 (GRCm39) missense probably damaging 1.00
R8295:Ints2 UTSW 11 86,115,914 (GRCm39) missense probably damaging 0.97
R8348:Ints2 UTSW 11 86,146,249 (GRCm39) missense probably benign
R8448:Ints2 UTSW 11 86,146,249 (GRCm39) missense probably benign
R8784:Ints2 UTSW 11 86,115,941 (GRCm39) nonsense probably null
R8784:Ints2 UTSW 11 86,112,963 (GRCm39) missense probably damaging 1.00
R8942:Ints2 UTSW 11 86,103,720 (GRCm39) missense probably benign 0.00
R9037:Ints2 UTSW 11 86,106,530 (GRCm39) missense probably benign
R9154:Ints2 UTSW 11 86,125,524 (GRCm39) missense probably damaging 1.00
R9397:Ints2 UTSW 11 86,135,311 (GRCm39) missense probably benign 0.01
R9412:Ints2 UTSW 11 86,117,589 (GRCm39) missense probably damaging 0.99
R9472:Ints2 UTSW 11 86,133,824 (GRCm39) missense
R9476:Ints2 UTSW 11 86,135,335 (GRCm39) missense probably benign
R9510:Ints2 UTSW 11 86,135,335 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- CCTGGCAAGTGACATTCTTCCACC -3'
(R):5'- AAGTTCCCAGGGTCTGCCTTCTAC -3'

Sequencing Primer
(F):5'- TTTAATGCACCTCAAGTTCAGAG -3'
(R):5'- TGCCTTCTACACTGTTTAAGTTG -3'
Posted On 2014-03-17