Incidental Mutation 'R1396:Senp1'
Institutional Source Beutler Lab
Gene Symbol Senp1
Ensembl Gene ENSMUSG00000033075
Gene NameSUMO1/sentrin specific peptidase 1
Synonyms2310046A20Rik, D15Ertd528e, E330036L07Rik
MMRRC Submission 039458-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1396 (G1)
Quality Score225
Status Not validated
Chromosomal Location98038744-98093744 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 98076554 bp
Amino Acid Change Serine to Proline at position 126 (S126P)
Ref Sequence ENSEMBL: ENSMUSP00000138056 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044189] [ENSMUST00000180657] [ENSMUST00000180716]
Predicted Effect probably benign
Transcript: ENSMUST00000044189
AA Change: S126P

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000046598
Gene: ENSMUSG00000033075
AA Change: S126P

low complexity region 38 47 N/A INTRINSIC
low complexity region 183 192 N/A INTRINSIC
low complexity region 223 235 N/A INTRINSIC
low complexity region 246 261 N/A INTRINSIC
low complexity region 357 375 N/A INTRINSIC
Pfam:Peptidase_C48 460 638 1.3e-49 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000180657
AA Change: S126P

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000138056
Gene: ENSMUSG00000033075
AA Change: S126P

low complexity region 38 47 N/A INTRINSIC
low complexity region 183 192 N/A INTRINSIC
low complexity region 223 235 N/A INTRINSIC
low complexity region 246 261 N/A INTRINSIC
low complexity region 383 401 N/A INTRINSIC
Pfam:Peptidase_C48 486 664 2e-49 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000180716
SMART Domains Protein: ENSMUSP00000138032
Gene: ENSMUSG00000033075

low complexity region 38 47 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181349
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.3%
  • 20x: 89.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a cysteine protease that specifically targets members of the small ubiquitin-like modifier (SUMO) protein family. This protease regulates SUMO pathways by deconjugating sumoylated proteins. This protease also functions to process the precursor SUMO proteins into their mature form. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Jun 2012]
PHENOTYPE: Homozygous mutant mice die before birth. Depending on the allele mice may exhibit placental labyrinth defects and widespread cell death or severe anemia and a defect in definitive erythropoiesis in the fetal liver. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921530L21Rik A G 14: 95,882,551 N248S probably benign Het
4930486L24Rik G A 13: 60,853,243 P160S probably benign Het
Adamts12 G T 15: 11,311,472 D1272Y probably benign Het
Akr1c20 A T 13: 4,507,727 V267D probably damaging Het
C1s1 A G 6: 124,531,051 S660P probably damaging Het
Ccdc40 A G 11: 119,231,803 T144A possibly damaging Het
Cdk20 T C 13: 64,437,403 I167T probably damaging Het
Chd6 A G 2: 160,983,103 L1212S probably damaging Het
Clock G C 5: 76,266,802 D15E probably benign Het
Clstn2 A G 9: 97,461,393 V667A probably benign Het
Cr2 A T 1: 195,169,253 probably null Het
Cyp2e1 A G 7: 140,773,079 D343G probably damaging Het
Dync1h1 G A 12: 110,636,509 E2195K probably benign Het
Etf1 G A 18: 34,908,167 T298I possibly damaging Het
Gm5431 T C 11: 48,895,434 probably benign Het
Gss G A 2: 155,567,721 T265I probably damaging Het
Heatr1 C T 13: 12,406,046 S406L possibly damaging Het
Hgsnat C A 8: 25,957,335 M310I possibly damaging Het
Inpp5b G A 4: 124,789,080 R598H probably damaging Het
Ints2 G T 11: 86,249,248 Q253K probably damaging Het
Kng1 A G 16: 23,078,980 M377V probably benign Het
Krt72 C T 15: 101,786,005 probably null Het
Lemd2 G C 17: 27,190,732 R482G probably damaging Het
Lrpprc C T 17: 84,726,303 D1049N possibly damaging Het
Lrrc49 A T 9: 60,680,527 H117Q probably damaging Het
Mcm6 A T 1: 128,351,476 F191Y probably damaging Het
Mecom T C 3: 29,979,800 T252A possibly damaging Het
Mgat4e T C 1: 134,541,533 T258A probably benign Het
Mpeg1 A G 19: 12,462,804 N542S probably damaging Het
Nln C T 13: 104,061,753 V184I probably benign Het
Nova1 A C 12: 46,816,893 F91L unknown Het
Polk T C 13: 96,484,208 I516V probably benign Het
Ppig C T 2: 69,749,018 P357S unknown Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Rasal2 A T 1: 157,164,666 H552Q probably damaging Het
Rnf41 G A 10: 128,435,571 E117K probably benign Het
Sbk3 A G 7: 4,967,453 Y306H possibly damaging Het
Sfr1 A G 19: 47,733,690 K182E probably benign Het
Slc25a4 C A 8: 46,209,288 R111L probably damaging Het
Slc9c1 A T 16: 45,573,347 Y551F probably benign Het
Stard4 A T 18: 33,206,210 N80K probably damaging Het
Tbk1 G A 10: 121,571,916 T104M probably damaging Het
Tedc2 T A 17: 24,216,317 E366V probably damaging Het
Tedc2 C A 17: 24,216,318 E366* probably null Het
Tmem102 A T 11: 69,804,370 W259R probably damaging Het
Tnk1 A T 11: 69,853,136 C466S probably benign Het
Tspoap1 A C 11: 87,766,120 Q307P probably damaging Het
Ugt2b35 A G 5: 87,011,530 N528D possibly damaging Het
Usp6nl A G 2: 6,426,998 probably null Het
Vmn1r203 C T 13: 22,524,508 T153M probably benign Het
Vmn1r89 T A 7: 13,220,011 S157T probably damaging Het
Vmn2r103 A T 17: 19,792,968 Y117F probably benign Het
Vmn2r116 A C 17: 23,386,141 M143L probably benign Het
Vmn2r62 A T 7: 42,764,837 D727E probably damaging Het
Vps13c A G 9: 67,955,022 I2974V probably benign Het
Wrn C T 8: 33,268,819 G769D probably damaging Het
Zhx3 T A 2: 160,781,020 H409L possibly damaging Het
Other mutations in Senp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00684:Senp1 APN 15 98064838 missense probably damaging 1.00
IGL01431:Senp1 APN 15 98082263 missense probably damaging 0.97
IGL02674:Senp1 APN 15 98056959 missense probably damaging 0.99
IGL03289:Senp1 APN 15 98085045 missense probably damaging 1.00
Calmate UTSW 15 98066498 missense probably benign 0.00
mustard UTSW 15 98048271 missense probably damaging 1.00
nitrogen UTSW 15 98066531 missense possibly damaging 0.61
Sinapis UTSW 15 98064880 splice site probably benign
PIT1430001:Senp1 UTSW 15 98084989 missense probably damaging 1.00
R0026:Senp1 UTSW 15 98076668 missense probably damaging 0.99
R0026:Senp1 UTSW 15 98076668 missense probably damaging 0.99
R0125:Senp1 UTSW 15 98048231 missense probably damaging 0.99
R0531:Senp1 UTSW 15 98064880 splice site probably benign
R1389:Senp1 UTSW 15 98075853 missense probably benign 0.03
R1786:Senp1 UTSW 15 98075967 missense probably benign 0.00
R1999:Senp1 UTSW 15 98058315 missense possibly damaging 0.61
R2045:Senp1 UTSW 15 98059944 missense possibly damaging 0.57
R2130:Senp1 UTSW 15 98075967 missense probably benign 0.00
R2132:Senp1 UTSW 15 98075967 missense probably benign 0.00
R2133:Senp1 UTSW 15 98075967 missense probably benign 0.00
R2150:Senp1 UTSW 15 98058315 missense possibly damaging 0.61
R2327:Senp1 UTSW 15 98082284 missense probably damaging 1.00
R3815:Senp1 UTSW 15 98056832 missense probably damaging 1.00
R4719:Senp1 UTSW 15 98056850 missense probably benign 0.42
R4766:Senp1 UTSW 15 98045896 missense probably damaging 0.98
R4866:Senp1 UTSW 15 98066848 missense possibly damaging 0.93
R5141:Senp1 UTSW 15 98076607 missense probably benign 0.08
R5485:Senp1 UTSW 15 98066496 missense probably benign 0.00
R5651:Senp1 UTSW 15 98076617 missense probably benign
R5668:Senp1 UTSW 15 98048355 missense probably damaging 1.00
R5729:Senp1 UTSW 15 98066531 missense possibly damaging 0.61
R6041:Senp1 UTSW 15 98058216 missense probably damaging 0.97
R6395:Senp1 UTSW 15 98048193 missense probably damaging 1.00
R6521:Senp1 UTSW 15 98048271 missense probably damaging 1.00
R7070:Senp1 UTSW 15 98082306 missense possibly damaging 0.66
R7075:Senp1 UTSW 15 98058326 missense probably benign 0.00
R7262:Senp1 UTSW 15 98066498 missense probably benign 0.00
R7625:Senp1 UTSW 15 98066798 missense probably benign 0.10
R8318:Senp1 UTSW 15 98064867 missense probably damaging 1.00
R8368:Senp1 UTSW 15 98045374 missense probably damaging 1.00
Predicted Primers PCR Primer

Sequencing Primer
(F):5'- cccagtgtccacaagtgtag -3'
Posted On2014-03-17