Incidental Mutation 'R1396:Kng1'
ID162676
Institutional Source Beutler Lab
Gene Symbol Kng1
Ensembl Gene ENSMUSG00000022875
Gene Namekininogen 1
SynonymsH-kininigen, L-kininogen
MMRRC Submission 039458-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1396 (G1)
Quality Score225
Status Not validated
Chromosome16
Chromosomal Location23057865-23082078 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 23078980 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Valine at position 377 (M377V)
Ref Sequence ENSEMBL: ENSMUSP00000087346 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023589] [ENSMUST00000039492] [ENSMUST00000089902]
Predicted Effect probably benign
Transcript: ENSMUST00000023589
AA Change: M377V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000023589
Gene: ENSMUSG00000022875
AA Change: M377V

DomainStartEndE-ValueType
CY 18 126 3.61e-17 SMART
CY 140 248 6.46e-28 SMART
CY 262 370 2.96e-36 SMART
low complexity region 439 450 N/A INTRINSIC
low complexity region 494 524 N/A INTRINSIC
low complexity region 541 555 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000039492
AA Change: M377V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000040485
Gene: ENSMUSG00000022875
AA Change: M377V

DomainStartEndE-ValueType
CY 18 126 3.61e-17 SMART
CY 140 248 6.46e-28 SMART
CY 262 370 2.96e-36 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000089902
AA Change: M377V

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000087346
Gene: ENSMUSG00000022875
AA Change: M377V

DomainStartEndE-ValueType
CY 18 126 3.61e-17 SMART
CY 140 248 6.46e-28 SMART
CY 262 370 2.96e-36 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136778
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.3%
  • 20x: 89.4%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a targeted null mutation are viable and grossly unaffected with normal tail vein bleeding times, despite loss of detectable plasma kininogen. However, homozygotes show a significantly longer time to carotid artery occlusion after RoseBengal and laser-induced arterial injury. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921530L21Rik A G 14: 95,882,551 N248S probably benign Het
4930486L24Rik G A 13: 60,853,243 P160S probably benign Het
Adamts12 G T 15: 11,311,472 D1272Y probably benign Het
Akr1c20 A T 13: 4,507,727 V267D probably damaging Het
C1s1 A G 6: 124,531,051 S660P probably damaging Het
Ccdc40 A G 11: 119,231,803 T144A possibly damaging Het
Cdk20 T C 13: 64,437,403 I167T probably damaging Het
Chd6 A G 2: 160,983,103 L1212S probably damaging Het
Clock G C 5: 76,266,802 D15E probably benign Het
Clstn2 A G 9: 97,461,393 V667A probably benign Het
Cr2 A T 1: 195,169,253 probably null Het
Cyp2e1 A G 7: 140,773,079 D343G probably damaging Het
Dync1h1 G A 12: 110,636,509 E2195K probably benign Het
Etf1 G A 18: 34,908,167 T298I possibly damaging Het
Gm5431 T C 11: 48,895,434 probably benign Het
Gss G A 2: 155,567,721 T265I probably damaging Het
Heatr1 C T 13: 12,406,046 S406L possibly damaging Het
Hgsnat C A 8: 25,957,335 M310I possibly damaging Het
Inpp5b G A 4: 124,789,080 R598H probably damaging Het
Ints2 G T 11: 86,249,248 Q253K probably damaging Het
Krt72 C T 15: 101,786,005 probably null Het
Lemd2 G C 17: 27,190,732 R482G probably damaging Het
Lrpprc C T 17: 84,726,303 D1049N possibly damaging Het
Lrrc49 A T 9: 60,680,527 H117Q probably damaging Het
Mcm6 A T 1: 128,351,476 F191Y probably damaging Het
Mecom T C 3: 29,979,800 T252A possibly damaging Het
Mgat4e T C 1: 134,541,533 T258A probably benign Het
Mpeg1 A G 19: 12,462,804 N542S probably damaging Het
Nln C T 13: 104,061,753 V184I probably benign Het
Nova1 A C 12: 46,816,893 F91L unknown Het
Polk T C 13: 96,484,208 I516V probably benign Het
Ppig C T 2: 69,749,018 P357S unknown Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Rasal2 A T 1: 157,164,666 H552Q probably damaging Het
Rnf41 G A 10: 128,435,571 E117K probably benign Het
Sbk3 A G 7: 4,967,453 Y306H possibly damaging Het
Senp1 A G 15: 98,076,554 S126P probably benign Het
Sfr1 A G 19: 47,733,690 K182E probably benign Het
Slc25a4 C A 8: 46,209,288 R111L probably damaging Het
Slc9c1 A T 16: 45,573,347 Y551F probably benign Het
Stard4 A T 18: 33,206,210 N80K probably damaging Het
Tbk1 G A 10: 121,571,916 T104M probably damaging Het
Tedc2 T A 17: 24,216,317 E366V probably damaging Het
Tedc2 C A 17: 24,216,318 E366* probably null Het
Tmem102 A T 11: 69,804,370 W259R probably damaging Het
Tnk1 A T 11: 69,853,136 C466S probably benign Het
Tspoap1 A C 11: 87,766,120 Q307P probably damaging Het
Ugt2b35 A G 5: 87,011,530 N528D possibly damaging Het
Usp6nl A G 2: 6,426,998 probably null Het
Vmn1r203 C T 13: 22,524,508 T153M probably benign Het
Vmn1r89 T A 7: 13,220,011 S157T probably damaging Het
Vmn2r103 A T 17: 19,792,968 Y117F probably benign Het
Vmn2r116 A C 17: 23,386,141 M143L probably benign Het
Vmn2r62 A T 7: 42,764,837 D727E probably damaging Het
Vps13c A G 9: 67,955,022 I2974V probably benign Het
Wrn C T 8: 33,268,819 G769D probably damaging Het
Zhx3 T A 2: 160,781,020 H409L possibly damaging Het
Other mutations in Kng1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01460:Kng1 APN 16 23079194 missense probably benign 0.26
IGL01754:Kng1 APN 16 23079614 missense probably benign 0.10
IGL02049:Kng1 APN 16 23073437 missense probably damaging 0.99
IGL02138:Kng1 APN 16 23067808 missense probably damaging 0.99
IGL02216:Kng1 APN 16 23058533 missense probably damaging 0.98
IGL02230:Kng1 APN 16 23060494 critical splice donor site probably null
IGL02630:Kng1 APN 16 23079845 utr 3 prime probably benign
IGL03024:Kng1 APN 16 23074692 missense possibly damaging 0.92
R0518:Kng1 UTSW 16 23060482 missense possibly damaging 0.70
R0521:Kng1 UTSW 16 23060482 missense possibly damaging 0.70
R1352:Kng1 UTSW 16 23067694 critical splice acceptor site probably null
R1514:Kng1 UTSW 16 23079760 missense probably damaging 0.97
R1753:Kng1 UTSW 16 23079119 missense possibly damaging 0.68
R2048:Kng1 UTSW 16 23058604 missense probably damaging 0.98
R2290:Kng1 UTSW 16 23079125 missense possibly damaging 0.79
R2357:Kng1 UTSW 16 23079065 missense possibly damaging 0.88
R3014:Kng1 UTSW 16 23079370 missense possibly damaging 0.72
R3607:Kng1 UTSW 16 23067802 missense probably damaging 1.00
R4322:Kng1 UTSW 16 23079520 missense probably benign
R4334:Kng1 UTSW 16 23079620 missense possibly damaging 0.88
R4388:Kng1 UTSW 16 23079318 missense possibly damaging 0.63
R4558:Kng1 UTSW 16 23077418 intron probably null
R4887:Kng1 UTSW 16 23067698 missense possibly damaging 0.71
R5115:Kng1 UTSW 16 23069282 missense possibly damaging 0.87
R5288:Kng1 UTSW 16 23079092 missense probably damaging 0.96
R5461:Kng1 UTSW 16 23079137 missense probably benign 0.19
R5894:Kng1 UTSW 16 23073363 missense probably benign 0.08
R6137:Kng1 UTSW 16 23074645 missense possibly damaging 0.56
R6260:Kng1 UTSW 16 23058621 missense possibly damaging 0.66
R6291:Kng1 UTSW 16 23079725 missense probably damaging 1.00
R6620:Kng1 UTSW 16 23081482 missense possibly damaging 0.74
R6947:Kng1 UTSW 16 23077374 missense probably benign 0.21
R7142:Kng1 UTSW 16 23079420 missense probably benign 0.25
R7166:Kng1 UTSW 16 23079678 missense probably benign 0.00
R7168:Kng1 UTSW 16 23079641 missense probably benign 0.26
R7347:Kng1 UTSW 16 23067787 missense possibly damaging 0.46
Z1176:Kng1 UTSW 16 23079616 missense probably benign 0.00
Z1177:Kng1 UTSW 16 23073389 missense probably benign 0.31
Predicted Primers PCR Primer
(F):5'- TGGCACAGCCTGACAAAGTTTAGC -3'
(R):5'- TTTCATGCAACCAGCCATGCCC -3'

Sequencing Primer
(F):5'- gtgctacagtacctgccc -3'
(R):5'- CATGTGTGGGTCCTTGTTCAG -3'
Posted On2014-03-17