Incidental Mutation 'R1396:Slc9c1'
ID 162677
Institutional Source Beutler Lab
Gene Symbol Slc9c1
Ensembl Gene ENSMUSG00000033210
Gene Name solute carrier family 9, subfamily C (Na+-transporting carboxylic acid decarboxylase), member 1
Synonyms LOC208169, spermNHE, Slc9a10
MMRRC Submission 039458-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.458) question?
Stock # R1396 (G1)
Quality Score 225
Status Not validated
Chromosome 16
Chromosomal Location 45355672-45427364 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 45393710 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 551 (Y551F)
Ref Sequence ENSEMBL: ENSMUSP00000124969 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000159945]
AlphaFold Q6UJY2
Predicted Effect probably benign
Transcript: ENSMUST00000159945
AA Change: Y551F

PolyPhen 2 Score 0.432 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000124969
Gene: ENSMUSG00000033210
AA Change: Y551F

DomainStartEndE-ValueType
Pfam:Na_H_Exchanger 40 445 2.3e-31 PFAM
low complexity region 588 602 N/A INTRINSIC
transmembrane domain 635 654 N/A INTRINSIC
transmembrane domain 669 686 N/A INTRINSIC
transmembrane domain 691 713 N/A INTRINSIC
low complexity region 734 743 N/A INTRINSIC
cNMP 890 1026 4.99e-1 SMART
low complexity region 1161 1175 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000162151
Predicted Effect probably benign
Transcript: ENSMUST00000162774
Meta Mutation Damage Score 0.1074 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.3%
  • 20x: 89.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] SLC9A10 is a member of the sodium-hydrogen exchanger (NHE) family (see SLC9A1, MIM 107310) and is required for male fertility and sperm motility (Wang et al., 2003 [PubMed 14634667]).[supplied by OMIM, Apr 2009]
PHENOTYPE: Homozygous null mice display male infertility and asthenozoospermia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930486L24Rik G A 13: 61,001,057 (GRCm39) P160S probably benign Het
Adamts12 G T 15: 11,311,558 (GRCm39) D1272Y probably benign Het
Akr1c20 A T 13: 4,557,726 (GRCm39) V267D probably damaging Het
C1s1 A G 6: 124,508,010 (GRCm39) S660P probably damaging Het
Ccdc202 A G 14: 96,119,987 (GRCm39) N248S probably benign Het
Ccdc40 A G 11: 119,122,629 (GRCm39) T144A possibly damaging Het
Cdk20 T C 13: 64,585,217 (GRCm39) I167T probably damaging Het
Chd6 A G 2: 160,825,023 (GRCm39) L1212S probably damaging Het
Clock G C 5: 76,414,649 (GRCm39) D15E probably benign Het
Clstn2 A G 9: 97,343,446 (GRCm39) V667A probably benign Het
Cr2 A T 1: 194,851,561 (GRCm39) probably null Het
Cyp2e1 A G 7: 140,352,992 (GRCm39) D343G probably damaging Het
Dync1h1 G A 12: 110,602,943 (GRCm39) E2195K probably benign Het
Etf1 G A 18: 35,041,220 (GRCm39) T298I possibly damaging Het
Gm5431 T C 11: 48,786,261 (GRCm39) probably benign Het
Gss G A 2: 155,409,641 (GRCm39) T265I probably damaging Het
Heatr1 C T 13: 12,420,927 (GRCm39) S406L possibly damaging Het
Hgsnat C A 8: 26,447,363 (GRCm39) M310I possibly damaging Het
Inpp5b G A 4: 124,682,873 (GRCm39) R598H probably damaging Het
Ints2 G T 11: 86,140,074 (GRCm39) Q253K probably damaging Het
Kng1 A G 16: 22,897,730 (GRCm39) M377V probably benign Het
Krt72 C T 15: 101,694,440 (GRCm39) probably null Het
Lemd2 G C 17: 27,409,706 (GRCm39) R482G probably damaging Het
Lrpprc C T 17: 85,033,731 (GRCm39) D1049N possibly damaging Het
Lrrc49 A T 9: 60,587,810 (GRCm39) H117Q probably damaging Het
Mcm6 A T 1: 128,279,213 (GRCm39) F191Y probably damaging Het
Mecom T C 3: 30,033,949 (GRCm39) T252A possibly damaging Het
Mgat4e T C 1: 134,469,271 (GRCm39) T258A probably benign Het
Mpeg1 A G 19: 12,440,168 (GRCm39) N542S probably damaging Het
Nln C T 13: 104,198,261 (GRCm39) V184I probably benign Het
Nova1 A C 12: 46,863,676 (GRCm39) F91L unknown Het
Polk T C 13: 96,620,716 (GRCm39) I516V probably benign Het
Ppig C T 2: 69,579,362 (GRCm39) P357S unknown Het
Ptpro T A 6: 137,420,592 (GRCm39) V1007D probably damaging Het
Rasal2 A T 1: 156,992,236 (GRCm39) H552Q probably damaging Het
Rnf41 G A 10: 128,271,440 (GRCm39) E117K probably benign Het
Sbk3 A G 7: 4,970,452 (GRCm39) Y306H possibly damaging Het
Senp1 A G 15: 97,974,435 (GRCm39) S126P probably benign Het
Sfr1 A G 19: 47,722,129 (GRCm39) K182E probably benign Het
Slc25a4 C A 8: 46,662,325 (GRCm39) R111L probably damaging Het
Stard4 A T 18: 33,339,263 (GRCm39) N80K probably damaging Het
Tbk1 G A 10: 121,407,821 (GRCm39) T104M probably damaging Het
Tedc2 C A 17: 24,435,292 (GRCm39) E366* probably null Het
Tedc2 T A 17: 24,435,291 (GRCm39) E366V probably damaging Het
Tmem102 A T 11: 69,695,196 (GRCm39) W259R probably damaging Het
Tnk1 A T 11: 69,743,962 (GRCm39) C466S probably benign Het
Tspoap1 A C 11: 87,656,946 (GRCm39) Q307P probably damaging Het
Ugt2b35 A G 5: 87,159,389 (GRCm39) N528D possibly damaging Het
Usp6nl A G 2: 6,431,809 (GRCm39) probably null Het
Vmn1r203 C T 13: 22,708,678 (GRCm39) T153M probably benign Het
Vmn1r89 T A 7: 12,953,938 (GRCm39) S157T probably damaging Het
Vmn2r103 A T 17: 20,013,230 (GRCm39) Y117F probably benign Het
Vmn2r116 A C 17: 23,605,115 (GRCm39) M143L probably benign Het
Vmn2r62 A T 7: 42,414,261 (GRCm39) D727E probably damaging Het
Vps13c A G 9: 67,862,304 (GRCm39) I2974V probably benign Het
Wrn C T 8: 33,758,847 (GRCm39) G769D probably damaging Het
Zhx3 T A 2: 160,622,940 (GRCm39) H409L possibly damaging Het
Other mutations in Slc9c1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00230:Slc9c1 APN 16 45,393,752 (GRCm39) missense possibly damaging 0.93
IGL00510:Slc9c1 APN 16 45,360,002 (GRCm39) missense probably benign 0.00
IGL00949:Slc9c1 APN 16 45,413,721 (GRCm39) missense probably benign
IGL01287:Slc9c1 APN 16 45,404,811 (GRCm39) nonsense probably null
IGL01536:Slc9c1 APN 16 45,409,992 (GRCm39) critical splice donor site probably null
IGL01655:Slc9c1 APN 16 45,403,335 (GRCm39) missense probably benign
IGL01671:Slc9c1 APN 16 45,380,678 (GRCm39) missense probably benign
IGL01720:Slc9c1 APN 16 45,376,132 (GRCm39) missense probably damaging 1.00
IGL01758:Slc9c1 APN 16 45,361,824 (GRCm39) missense probably damaging 1.00
IGL02031:Slc9c1 APN 16 45,419,833 (GRCm39) missense probably benign 0.00
IGL02321:Slc9c1 APN 16 45,376,977 (GRCm39) missense probably benign 0.02
IGL02472:Slc9c1 APN 16 45,400,505 (GRCm39) missense probably benign 0.10
IGL02516:Slc9c1 APN 16 45,398,238 (GRCm39) missense probably damaging 0.96
IGL02732:Slc9c1 APN 16 45,370,548 (GRCm39) missense possibly damaging 0.78
IGL02741:Slc9c1 APN 16 45,401,961 (GRCm39) missense possibly damaging 0.48
IGL02795:Slc9c1 APN 16 45,395,782 (GRCm39) missense probably benign 0.06
IGL03032:Slc9c1 APN 16 45,363,624 (GRCm39) splice site probably benign
IGL03062:Slc9c1 APN 16 45,420,121 (GRCm39) missense probably benign 0.20
IGL03184:Slc9c1 APN 16 45,368,003 (GRCm39) missense probably damaging 1.00
IGL03351:Slc9c1 APN 16 45,363,531 (GRCm39) missense probably benign 0.01
P0041:Slc9c1 UTSW 16 45,370,524 (GRCm39) missense possibly damaging 0.65
R0052:Slc9c1 UTSW 16 45,427,219 (GRCm39) utr 3 prime probably benign
R0107:Slc9c1 UTSW 16 45,395,783 (GRCm39) missense probably benign 0.00
R0255:Slc9c1 UTSW 16 45,374,663 (GRCm39) missense probably benign 0.25
R0316:Slc9c1 UTSW 16 45,400,595 (GRCm39) missense possibly damaging 0.72
R0437:Slc9c1 UTSW 16 45,420,250 (GRCm39) splice site probably benign
R0611:Slc9c1 UTSW 16 45,401,965 (GRCm39) missense possibly damaging 0.83
R0624:Slc9c1 UTSW 16 45,393,719 (GRCm39) missense probably benign 0.00
R0630:Slc9c1 UTSW 16 45,363,483 (GRCm39) splice site probably benign
R1106:Slc9c1 UTSW 16 45,376,170 (GRCm39) missense possibly damaging 0.66
R1727:Slc9c1 UTSW 16 45,422,324 (GRCm39) missense probably benign 0.27
R1732:Slc9c1 UTSW 16 45,373,291 (GRCm39) missense probably benign 0.21
R1754:Slc9c1 UTSW 16 45,409,872 (GRCm39) missense probably benign 0.11
R1799:Slc9c1 UTSW 16 45,374,652 (GRCm39) missense probably damaging 1.00
R1802:Slc9c1 UTSW 16 45,378,644 (GRCm39) missense probably benign
R1813:Slc9c1 UTSW 16 45,393,710 (GRCm39) missense probably benign 0.43
R1972:Slc9c1 UTSW 16 45,413,835 (GRCm39) missense possibly damaging 0.89
R1985:Slc9c1 UTSW 16 45,370,469 (GRCm39) missense probably benign 0.01
R1995:Slc9c1 UTSW 16 45,374,618 (GRCm39) missense probably damaging 0.99
R2045:Slc9c1 UTSW 16 45,400,613 (GRCm39) missense probably damaging 1.00
R2146:Slc9c1 UTSW 16 45,413,827 (GRCm39) missense probably benign 0.19
R2511:Slc9c1 UTSW 16 45,365,099 (GRCm39) missense possibly damaging 0.79
R3716:Slc9c1 UTSW 16 45,400,582 (GRCm39) missense probably benign
R3765:Slc9c1 UTSW 16 45,411,244 (GRCm39) missense possibly damaging 0.89
R3936:Slc9c1 UTSW 16 45,427,193 (GRCm39) utr 3 prime probably benign
R4051:Slc9c1 UTSW 16 45,363,593 (GRCm39) missense probably damaging 1.00
R4302:Slc9c1 UTSW 16 45,365,154 (GRCm39) missense probably benign 0.35
R4433:Slc9c1 UTSW 16 45,419,829 (GRCm39) missense possibly damaging 0.93
R4651:Slc9c1 UTSW 16 45,367,756 (GRCm39) makesense probably null
R4928:Slc9c1 UTSW 16 45,395,772 (GRCm39) missense probably benign 0.42
R4957:Slc9c1 UTSW 16 45,365,194 (GRCm39) missense probably benign 0.45
R4989:Slc9c1 UTSW 16 45,413,800 (GRCm39) missense probably benign 0.03
R5478:Slc9c1 UTSW 16 45,374,609 (GRCm39) missense probably damaging 1.00
R5534:Slc9c1 UTSW 16 45,376,977 (GRCm39) missense probably benign 0.00
R5898:Slc9c1 UTSW 16 45,365,123 (GRCm39) missense probably damaging 1.00
R5939:Slc9c1 UTSW 16 45,368,031 (GRCm39) missense probably benign 0.00
R6110:Slc9c1 UTSW 16 45,395,731 (GRCm39) missense probably damaging 1.00
R6115:Slc9c1 UTSW 16 45,376,132 (GRCm39) missense probably damaging 1.00
R6277:Slc9c1 UTSW 16 45,427,204 (GRCm39) utr 3 prime probably benign
R6286:Slc9c1 UTSW 16 45,398,194 (GRCm39) missense probably benign 0.14
R7268:Slc9c1 UTSW 16 45,370,479 (GRCm39) missense probably damaging 1.00
R7272:Slc9c1 UTSW 16 45,401,878 (GRCm39) missense possibly damaging 0.89
R7431:Slc9c1 UTSW 16 45,413,847 (GRCm39) missense probably damaging 1.00
R7573:Slc9c1 UTSW 16 45,398,256 (GRCm39) missense probably benign 0.00
R7881:Slc9c1 UTSW 16 45,403,332 (GRCm39) missense probably benign 0.00
R8207:Slc9c1 UTSW 16 45,360,076 (GRCm39) missense possibly damaging 0.65
R8289:Slc9c1 UTSW 16 45,403,344 (GRCm39) missense probably benign 0.09
R8302:Slc9c1 UTSW 16 45,368,058 (GRCm39) missense probably benign
R8328:Slc9c1 UTSW 16 45,398,227 (GRCm39) missense probably damaging 0.97
R8421:Slc9c1 UTSW 16 45,413,734 (GRCm39) missense probably damaging 0.97
R8691:Slc9c1 UTSW 16 45,427,182 (GRCm39) missense probably benign 0.00
R8712:Slc9c1 UTSW 16 45,380,646 (GRCm39) missense probably benign 0.00
R9128:Slc9c1 UTSW 16 45,400,490 (GRCm39) missense probably benign 0.25
R9191:Slc9c1 UTSW 16 45,420,144 (GRCm39) missense possibly damaging 0.57
R9230:Slc9c1 UTSW 16 45,398,275 (GRCm39) missense possibly damaging 0.93
R9248:Slc9c1 UTSW 16 45,370,551 (GRCm39) missense probably benign 0.01
R9417:Slc9c1 UTSW 16 45,413,848 (GRCm39) missense probably benign 0.45
R9519:Slc9c1 UTSW 16 45,395,770 (GRCm39) missense probably damaging 1.00
R9570:Slc9c1 UTSW 16 45,380,705 (GRCm39) missense probably benign 0.13
R9686:Slc9c1 UTSW 16 45,400,577 (GRCm39) missense possibly damaging 0.72
R9695:Slc9c1 UTSW 16 45,368,026 (GRCm39) missense probably benign 0.00
R9742:Slc9c1 UTSW 16 45,400,616 (GRCm39) missense probably damaging 1.00
V8831:Slc9c1 UTSW 16 45,398,262 (GRCm39) missense possibly damaging 0.89
Z1176:Slc9c1 UTSW 16 45,378,601 (GRCm39) missense possibly damaging 0.48
Z1177:Slc9c1 UTSW 16 45,393,782 (GRCm39) frame shift probably null
Predicted Primers PCR Primer
(F):5'- GGCTGTGAACTATTTGGCAACAGGG -3'
(R):5'- TGCGGAGACTAAGGAACACTTGGC -3'

Sequencing Primer
(F):5'- ttggcaacagggaattcaac -3'
(R):5'- CCCTATGCAGGTGTTCAGAGAG -3'
Posted On 2014-03-17