Incidental Mutation 'R1396:Lemd2'
ID162682
Institutional Source Beutler Lab
Gene Symbol Lemd2
Ensembl Gene ENSMUSG00000044857
Gene NameLEM domain containing 2
SynonymsNET25, Lem2
MMRRC Submission 039458-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1396 (G1)
Quality Score135
Status Not validated
Chromosome17
Chromosomal Location27189601-27204438 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to C at 27190732 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glycine at position 482 (R482G)
Ref Sequence ENSEMBL: ENSMUSP00000058221 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055117]
Predicted Effect probably damaging
Transcript: ENSMUST00000055117
AA Change: R482G

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000058221
Gene: ENSMUSG00000044857
AA Change: R482G

DomainStartEndE-ValueType
LEM 1 42 2.19e-16 SMART
low complexity region 65 86 N/A INTRINSIC
low complexity region 91 112 N/A INTRINSIC
low complexity region 172 183 N/A INTRINSIC
transmembrane domain 221 239 N/A INTRINSIC
Pfam:MSC 251 503 7.3e-21 PFAM
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.3%
  • 20x: 89.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a LEM domain-containing transmembrane protein of the inner nuclear membrane. The protein is involved in nuclear structure organization and plays a role in cell signaling and differentiation. Mutations in this gene result in Cataract 46, juvenile-onset. Multiple transcript variants have been found for this gene. [provided by RefSeq, Feb 2017]
PHENOTYPE: Homozygotes for a gene-trapped allele die by E11.5 exhibiting reduced embryo size and cell density in neural tissue and mesenchyme, underdeveloped cardiac and neural tissue, and hyperactivation of MAPK and AKT signaling. Heterozygotes show a modest delayin cardiotoxin-induced muscle regeneration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921530L21Rik A G 14: 95,882,551 N248S probably benign Het
4930486L24Rik G A 13: 60,853,243 P160S probably benign Het
Adamts12 G T 15: 11,311,472 D1272Y probably benign Het
Akr1c20 A T 13: 4,507,727 V267D probably damaging Het
C1s1 A G 6: 124,531,051 S660P probably damaging Het
Ccdc40 A G 11: 119,231,803 T144A possibly damaging Het
Cdk20 T C 13: 64,437,403 I167T probably damaging Het
Chd6 A G 2: 160,983,103 L1212S probably damaging Het
Clock G C 5: 76,266,802 D15E probably benign Het
Clstn2 A G 9: 97,461,393 V667A probably benign Het
Cr2 A T 1: 195,169,253 probably null Het
Cyp2e1 A G 7: 140,773,079 D343G probably damaging Het
Dync1h1 G A 12: 110,636,509 E2195K probably benign Het
Etf1 G A 18: 34,908,167 T298I possibly damaging Het
Gm5431 T C 11: 48,895,434 probably benign Het
Gss G A 2: 155,567,721 T265I probably damaging Het
Heatr1 C T 13: 12,406,046 S406L possibly damaging Het
Hgsnat C A 8: 25,957,335 M310I possibly damaging Het
Inpp5b G A 4: 124,789,080 R598H probably damaging Het
Ints2 G T 11: 86,249,248 Q253K probably damaging Het
Kng1 A G 16: 23,078,980 M377V probably benign Het
Krt72 C T 15: 101,786,005 probably null Het
Lrpprc C T 17: 84,726,303 D1049N possibly damaging Het
Lrrc49 A T 9: 60,680,527 H117Q probably damaging Het
Mcm6 A T 1: 128,351,476 F191Y probably damaging Het
Mecom T C 3: 29,979,800 T252A possibly damaging Het
Mgat4e T C 1: 134,541,533 T258A probably benign Het
Mpeg1 A G 19: 12,462,804 N542S probably damaging Het
Nln C T 13: 104,061,753 V184I probably benign Het
Nova1 A C 12: 46,816,893 F91L unknown Het
Polk T C 13: 96,484,208 I516V probably benign Het
Ppig C T 2: 69,749,018 P357S unknown Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Rasal2 A T 1: 157,164,666 H552Q probably damaging Het
Rnf41 G A 10: 128,435,571 E117K probably benign Het
Sbk3 A G 7: 4,967,453 Y306H possibly damaging Het
Senp1 A G 15: 98,076,554 S126P probably benign Het
Sfr1 A G 19: 47,733,690 K182E probably benign Het
Slc25a4 C A 8: 46,209,288 R111L probably damaging Het
Slc9c1 A T 16: 45,573,347 Y551F probably benign Het
Stard4 A T 18: 33,206,210 N80K probably damaging Het
Tbk1 G A 10: 121,571,916 T104M probably damaging Het
Tedc2 T A 17: 24,216,317 E366V probably damaging Het
Tedc2 C A 17: 24,216,318 E366* probably null Het
Tmem102 A T 11: 69,804,370 W259R probably damaging Het
Tnk1 A T 11: 69,853,136 C466S probably benign Het
Tspoap1 A C 11: 87,766,120 Q307P probably damaging Het
Ugt2b35 A G 5: 87,011,530 N528D possibly damaging Het
Usp6nl A G 2: 6,426,998 probably null Het
Vmn1r203 C T 13: 22,524,508 T153M probably benign Het
Vmn1r89 T A 7: 13,220,011 S157T probably damaging Het
Vmn2r103 A T 17: 19,792,968 Y117F probably benign Het
Vmn2r116 A C 17: 23,386,141 M143L probably benign Het
Vmn2r62 A T 7: 42,764,837 D727E probably damaging Het
Vps13c A G 9: 67,955,022 I2974V probably benign Het
Wrn C T 8: 33,268,819 G769D probably damaging Het
Zhx3 T A 2: 160,781,020 H409L possibly damaging Het
Other mutations in Lemd2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01791:Lemd2 APN 17 27190728 missense probably damaging 1.00
IGL02161:Lemd2 APN 17 27190651 missense probably damaging 1.00
IGL02903:Lemd2 APN 17 27193210 splice site probably benign
R0078:Lemd2 UTSW 17 27203728 missense probably benign 0.17
R0458:Lemd2 UTSW 17 27190653 missense probably damaging 0.99
R3106:Lemd2 UTSW 17 27201670 missense probably damaging 1.00
R4319:Lemd2 UTSW 17 27201677 missense possibly damaging 0.87
R4930:Lemd2 UTSW 17 27193832 splice site probably null
R5172:Lemd2 UTSW 17 27195382 nonsense probably null
R5239:Lemd2 UTSW 17 27203799 missense possibly damaging 0.53
R6005:Lemd2 UTSW 17 27190785 missense probably damaging 1.00
R6196:Lemd2 UTSW 17 27193002 nonsense probably null
R6621:Lemd2 UTSW 17 27195392 missense probably benign 0.01
R7208:Lemd2 UTSW 17 27196191 missense probably damaging 1.00
R7552:Lemd2 UTSW 17 27193836 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TGAATGAGCACCAAAGGTCTGTGTC -3'
(R):5'- TGCATCTGAGCTAAGCACAGTCCC -3'

Sequencing Primer
(F):5'- ACCAAAGGTCTGTGTCCTTGC -3'
(R):5'- AGCTCTGTACCAAGGCTTGTG -3'
Posted On2014-03-17