Incidental Mutation 'R1396:Lrpprc'
ID 162683
Institutional Source Beutler Lab
Gene Symbol Lrpprc
Ensembl Gene ENSMUSG00000024120
Gene Name leucine-rich PPR-motif containing
Synonyms Lrp130, 3110001K13Rik
MMRRC Submission 039458-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R1396 (G1)
Quality Score 225
Status Not validated
Chromosome 17
Chromosomal Location 85012675-85098214 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 85033731 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Asparagine at position 1049 (D1049N)
Ref Sequence ENSEMBL: ENSMUSP00000107927 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000112308]
AlphaFold Q6PB66
Predicted Effect possibly damaging
Transcript: ENSMUST00000112308
AA Change: D1049N

PolyPhen 2 Score 0.679 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000107927
Gene: ENSMUSG00000024120
AA Change: D1049N

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
low complexity region 32 50 N/A INTRINSIC
low complexity region 123 136 N/A INTRINSIC
Pfam:PPR_3 196 228 9.1e-4 PFAM
Pfam:PPR 197 227 2.3e-4 PFAM
Pfam:PPR_3 231 264 7.9e-6 PFAM
Pfam:PPR 232 262 4e-4 PFAM
Pfam:PPR_3 266 297 9.7e-3 PFAM
internal_repeat_2 391 477 3.13e-7 PROSPERO
Pfam:PPR 750 778 3.4e-4 PFAM
low complexity region 1017 1028 N/A INTRINSIC
internal_repeat_1 1042 1362 1.09e-11 PROSPERO
low complexity region 1366 1375 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000160011
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162799
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.3%
  • 20x: 89.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a leucine-rich protein that has multiple pentatricopeptide repeats (PPR). The precise role of this protein is unknown but studies suggest it may play a role in cytoskeletal organization, vesicular transport, or in transcriptional regulation of both nuclear and mitochondrial genes. The protein localizes primarily to mitochondria and is predicted to have an N-terminal mitochondrial targeting sequence. Mutations in this gene are associated with the French-Canadian type of Leigh syndrome. [provided by RefSeq, Mar 2012]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit embryonic lethality during organogenesis associated with growth retardation. Mice homozygous for a knock-out allele exhibit embryonic lethality between somite formation and embryo turning. [provided by MGI curators]
Allele List at MGI

All alleles(13) : Targeted(3) Gene trapped(10)

Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930486L24Rik G A 13: 61,001,057 (GRCm39) P160S probably benign Het
Adamts12 G T 15: 11,311,558 (GRCm39) D1272Y probably benign Het
Akr1c20 A T 13: 4,557,726 (GRCm39) V267D probably damaging Het
C1s1 A G 6: 124,508,010 (GRCm39) S660P probably damaging Het
Ccdc202 A G 14: 96,119,987 (GRCm39) N248S probably benign Het
Ccdc40 A G 11: 119,122,629 (GRCm39) T144A possibly damaging Het
Cdk20 T C 13: 64,585,217 (GRCm39) I167T probably damaging Het
Chd6 A G 2: 160,825,023 (GRCm39) L1212S probably damaging Het
Clock G C 5: 76,414,649 (GRCm39) D15E probably benign Het
Clstn2 A G 9: 97,343,446 (GRCm39) V667A probably benign Het
Cr2 A T 1: 194,851,561 (GRCm39) probably null Het
Cyp2e1 A G 7: 140,352,992 (GRCm39) D343G probably damaging Het
Dync1h1 G A 12: 110,602,943 (GRCm39) E2195K probably benign Het
Etf1 G A 18: 35,041,220 (GRCm39) T298I possibly damaging Het
Gm5431 T C 11: 48,786,261 (GRCm39) probably benign Het
Gss G A 2: 155,409,641 (GRCm39) T265I probably damaging Het
Heatr1 C T 13: 12,420,927 (GRCm39) S406L possibly damaging Het
Hgsnat C A 8: 26,447,363 (GRCm39) M310I possibly damaging Het
Inpp5b G A 4: 124,682,873 (GRCm39) R598H probably damaging Het
Ints2 G T 11: 86,140,074 (GRCm39) Q253K probably damaging Het
Kng1 A G 16: 22,897,730 (GRCm39) M377V probably benign Het
Krt72 C T 15: 101,694,440 (GRCm39) probably null Het
Lemd2 G C 17: 27,409,706 (GRCm39) R482G probably damaging Het
Lrrc49 A T 9: 60,587,810 (GRCm39) H117Q probably damaging Het
Mcm6 A T 1: 128,279,213 (GRCm39) F191Y probably damaging Het
Mecom T C 3: 30,033,949 (GRCm39) T252A possibly damaging Het
Mgat4e T C 1: 134,469,271 (GRCm39) T258A probably benign Het
Mpeg1 A G 19: 12,440,168 (GRCm39) N542S probably damaging Het
Nln C T 13: 104,198,261 (GRCm39) V184I probably benign Het
Nova1 A C 12: 46,863,676 (GRCm39) F91L unknown Het
Polk T C 13: 96,620,716 (GRCm39) I516V probably benign Het
Ppig C T 2: 69,579,362 (GRCm39) P357S unknown Het
Ptpro T A 6: 137,420,592 (GRCm39) V1007D probably damaging Het
Rasal2 A T 1: 156,992,236 (GRCm39) H552Q probably damaging Het
Rnf41 G A 10: 128,271,440 (GRCm39) E117K probably benign Het
Sbk3 A G 7: 4,970,452 (GRCm39) Y306H possibly damaging Het
Senp1 A G 15: 97,974,435 (GRCm39) S126P probably benign Het
Sfr1 A G 19: 47,722,129 (GRCm39) K182E probably benign Het
Slc25a4 C A 8: 46,662,325 (GRCm39) R111L probably damaging Het
Slc9c1 A T 16: 45,393,710 (GRCm39) Y551F probably benign Het
Stard4 A T 18: 33,339,263 (GRCm39) N80K probably damaging Het
Tbk1 G A 10: 121,407,821 (GRCm39) T104M probably damaging Het
Tedc2 C A 17: 24,435,292 (GRCm39) E366* probably null Het
Tedc2 T A 17: 24,435,291 (GRCm39) E366V probably damaging Het
Tmem102 A T 11: 69,695,196 (GRCm39) W259R probably damaging Het
Tnk1 A T 11: 69,743,962 (GRCm39) C466S probably benign Het
Tspoap1 A C 11: 87,656,946 (GRCm39) Q307P probably damaging Het
Ugt2b35 A G 5: 87,159,389 (GRCm39) N528D possibly damaging Het
Usp6nl A G 2: 6,431,809 (GRCm39) probably null Het
Vmn1r203 C T 13: 22,708,678 (GRCm39) T153M probably benign Het
Vmn1r89 T A 7: 12,953,938 (GRCm39) S157T probably damaging Het
Vmn2r103 A T 17: 20,013,230 (GRCm39) Y117F probably benign Het
Vmn2r116 A C 17: 23,605,115 (GRCm39) M143L probably benign Het
Vmn2r62 A T 7: 42,414,261 (GRCm39) D727E probably damaging Het
Vps13c A G 9: 67,862,304 (GRCm39) I2974V probably benign Het
Wrn C T 8: 33,758,847 (GRCm39) G769D probably damaging Het
Zhx3 T A 2: 160,622,940 (GRCm39) H409L possibly damaging Het
Other mutations in Lrpprc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00341:Lrpprc APN 17 85,057,953 (GRCm39) missense possibly damaging 0.91
IGL01319:Lrpprc APN 17 85,012,840 (GRCm39) utr 3 prime probably benign
IGL01380:Lrpprc APN 17 85,030,158 (GRCm39) missense probably benign
IGL01560:Lrpprc APN 17 85,015,547 (GRCm39) missense probably benign 0.07
IGL01582:Lrpprc APN 17 85,061,971 (GRCm39) missense probably null 0.00
IGL01996:Lrpprc APN 17 85,080,698 (GRCm39) missense probably benign
IGL02109:Lrpprc APN 17 85,033,998 (GRCm39) nonsense probably null
IGL02163:Lrpprc APN 17 85,060,900 (GRCm39) missense probably damaging 0.97
IGL02248:Lrpprc APN 17 85,078,895 (GRCm39) missense probably damaging 0.99
IGL02503:Lrpprc APN 17 85,033,767 (GRCm39) missense probably benign
IGL02545:Lrpprc APN 17 85,082,853 (GRCm39) missense probably benign
IGL02570:Lrpprc APN 17 85,057,981 (GRCm39) missense probably damaging 1.00
IGL02636:Lrpprc APN 17 85,060,532 (GRCm39) unclassified probably benign
IGL02943:Lrpprc APN 17 85,078,878 (GRCm39) missense probably benign 0.00
IGL03008:Lrpprc APN 17 85,058,675 (GRCm39) missense probably benign 0.05
elusory UTSW 17 85,020,215 (GRCm39) missense probably benign 0.01
phantom UTSW 17 85,079,575 (GRCm39) missense probably damaging 1.00
R6807_Lrpprc_629 UTSW 17 85,056,531 (GRCm39) missense possibly damaging 0.93
Stereotype UTSW 17 85,074,483 (GRCm39) missense probably damaging 1.00
thus UTSW 17 85,078,355 (GRCm39) missense probably benign 0.01
P0023:Lrpprc UTSW 17 85,033,766 (GRCm39) missense probably benign 0.00
R0027:Lrpprc UTSW 17 85,074,435 (GRCm39) nonsense probably null
R0027:Lrpprc UTSW 17 85,074,435 (GRCm39) nonsense probably null
R0302:Lrpprc UTSW 17 85,047,506 (GRCm39) missense possibly damaging 0.76
R0389:Lrpprc UTSW 17 85,060,540 (GRCm39) critical splice donor site probably null
R0448:Lrpprc UTSW 17 85,078,322 (GRCm39) missense probably benign 0.09
R1759:Lrpprc UTSW 17 85,047,509 (GRCm39) missense probably damaging 1.00
R2019:Lrpprc UTSW 17 85,059,759 (GRCm39) missense possibly damaging 0.56
R2169:Lrpprc UTSW 17 85,077,505 (GRCm39) missense probably benign 0.00
R2312:Lrpprc UTSW 17 85,080,686 (GRCm39) missense probably damaging 0.96
R2319:Lrpprc UTSW 17 85,033,818 (GRCm39) missense probably benign
R2568:Lrpprc UTSW 17 85,034,077 (GRCm39) missense probably damaging 1.00
R3013:Lrpprc UTSW 17 85,074,497 (GRCm39) missense probably benign 0.04
R3620:Lrpprc UTSW 17 85,077,452 (GRCm39) missense probably benign 0.01
R3789:Lrpprc UTSW 17 85,078,956 (GRCm39) missense probably benign 0.25
R3848:Lrpprc UTSW 17 85,078,355 (GRCm39) missense probably benign 0.01
R3973:Lrpprc UTSW 17 85,078,269 (GRCm39) critical splice donor site probably null
R4111:Lrpprc UTSW 17 85,033,766 (GRCm39) missense probably benign 0.00
R4164:Lrpprc UTSW 17 85,038,617 (GRCm39) missense possibly damaging 0.47
R4331:Lrpprc UTSW 17 85,047,970 (GRCm39) critical splice donor site probably null
R4531:Lrpprc UTSW 17 85,020,215 (GRCm39) missense probably benign 0.01
R4832:Lrpprc UTSW 17 85,014,584 (GRCm39) missense probably benign 0.24
R4947:Lrpprc UTSW 17 85,078,966 (GRCm39) missense probably benign 0.02
R5134:Lrpprc UTSW 17 85,058,684 (GRCm39) missense probably benign 0.00
R5333:Lrpprc UTSW 17 85,097,821 (GRCm39) missense probably benign 0.01
R5950:Lrpprc UTSW 17 85,047,598 (GRCm39) missense possibly damaging 0.86
R5972:Lrpprc UTSW 17 85,020,250 (GRCm39) missense possibly damaging 0.88
R6185:Lrpprc UTSW 17 85,074,452 (GRCm39) missense probably benign
R6253:Lrpprc UTSW 17 85,048,065 (GRCm39) missense probably benign 0.00
R6488:Lrpprc UTSW 17 85,058,781 (GRCm39) missense probably damaging 1.00
R6807:Lrpprc UTSW 17 85,056,531 (GRCm39) missense possibly damaging 0.93
R6911:Lrpprc UTSW 17 85,063,711 (GRCm39) missense possibly damaging 0.67
R6933:Lrpprc UTSW 17 85,030,131 (GRCm39) missense probably benign 0.42
R6955:Lrpprc UTSW 17 85,084,417 (GRCm39) missense probably damaging 0.98
R7448:Lrpprc UTSW 17 85,079,567 (GRCm39) missense probably damaging 0.99
R7727:Lrpprc UTSW 17 85,084,375 (GRCm39) missense probably benign 0.00
R8003:Lrpprc UTSW 17 85,059,745 (GRCm39) missense probably benign 0.01
R8178:Lrpprc UTSW 17 85,079,575 (GRCm39) missense probably damaging 1.00
R8310:Lrpprc UTSW 17 85,080,524 (GRCm39) missense probably damaging 1.00
R8322:Lrpprc UTSW 17 85,047,496 (GRCm39) critical splice donor site probably null
R8389:Lrpprc UTSW 17 85,080,742 (GRCm39) missense possibly damaging 0.79
R8560:Lrpprc UTSW 17 85,047,495 (GRCm39) splice site probably benign
R8777:Lrpprc UTSW 17 85,058,657 (GRCm39) missense probably benign 0.30
R8777-TAIL:Lrpprc UTSW 17 85,058,657 (GRCm39) missense probably benign 0.30
R8868:Lrpprc UTSW 17 85,078,920 (GRCm39) missense probably damaging 0.99
R8970:Lrpprc UTSW 17 85,074,483 (GRCm39) missense probably damaging 1.00
R9042:Lrpprc UTSW 17 85,059,736 (GRCm39) critical splice donor site probably null
R9493:Lrpprc UTSW 17 85,015,548 (GRCm39) missense probably damaging 0.99
R9664:Lrpprc UTSW 17 85,020,262 (GRCm39) missense probably damaging 0.99
X0026:Lrpprc UTSW 17 85,018,090 (GRCm39) missense probably benign 0.42
Z1088:Lrpprc UTSW 17 85,077,928 (GRCm39) critical splice acceptor site probably null
Z1088:Lrpprc UTSW 17 85,039,212 (GRCm39) nonsense probably null
Z1176:Lrpprc UTSW 17 85,077,859 (GRCm39) missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- GGCCACATGGCATTTCTTTGCTC -3'
(R):5'- AAGACTTCCAGGACTTAGCTTAGCTCA -3'

Sequencing Primer
(F):5'- TGCTCTTGTTTTCACCCTTAAATAC -3'
(R):5'- GGACTTAGCTTAGCTCAGTTTTATAC -3'
Posted On 2014-03-17