Incidental Mutation 'R1396:Lrpprc'
ID162683
Institutional Source Beutler Lab
Gene Symbol Lrpprc
Ensembl Gene ENSMUSG00000024120
Gene Nameleucine-rich PPR-motif containing
Synonyms3110001K13Rik, Lrp130
MMRRC Submission 039458-MU
Accession Numbers

Ncbi RefSeq: NM_028233.2; MGI:1919666

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1396 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location84705247-84790789 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 84726303 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Asparagine at position 1049 (D1049N)
Ref Sequence ENSEMBL: ENSMUSP00000107927 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000112308]
Predicted Effect possibly damaging
Transcript: ENSMUST00000112308
AA Change: D1049N

PolyPhen 2 Score 0.679 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000107927
Gene: ENSMUSG00000024120
AA Change: D1049N

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
low complexity region 32 50 N/A INTRINSIC
low complexity region 123 136 N/A INTRINSIC
Pfam:PPR_3 196 228 9.1e-4 PFAM
Pfam:PPR 197 227 2.3e-4 PFAM
Pfam:PPR_3 231 264 7.9e-6 PFAM
Pfam:PPR 232 262 4e-4 PFAM
Pfam:PPR_3 266 297 9.7e-3 PFAM
internal_repeat_2 391 477 3.13e-7 PROSPERO
Pfam:PPR 750 778 3.4e-4 PFAM
low complexity region 1017 1028 N/A INTRINSIC
internal_repeat_1 1042 1362 1.09e-11 PROSPERO
low complexity region 1366 1375 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000160011
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162799
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.3%
  • 20x: 89.4%
Validation Efficiency
MGI Phenotype Strain: 3857306; 5438913
Lethality: E10-E12
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a leucine-rich protein that has multiple pentatricopeptide repeats (PPR). The precise role of this protein is unknown but studies suggest it may play a role in cytoskeletal organization, vesicular transport, or in transcriptional regulation of both nuclear and mitochondrial genes. The protein localizes primarily to mitochondria and is predicted to have an N-terminal mitochondrial targeting sequence. Mutations in this gene are associated with the French-Canadian type of Leigh syndrome. [provided by RefSeq, Mar 2012]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit embryonic lethality during organogenesis associated with growth retardation. Mice homozygous for a knock-out allele exhibit embryonic lethality between somite formation and embryo turning. [provided by MGI curators]
Allele List at MGI

All alleles(13) : Targeted(3) Gene trapped(10)

Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921530L21Rik A G 14: 95,882,551 N248S probably benign Het
4930486L24Rik G A 13: 60,853,243 P160S probably benign Het
Adamts12 G T 15: 11,311,472 D1272Y probably benign Het
Akr1c20 A T 13: 4,507,727 V267D probably damaging Het
C1s1 A G 6: 124,531,051 S660P probably damaging Het
Ccdc40 A G 11: 119,231,803 T144A possibly damaging Het
Cdk20 T C 13: 64,437,403 I167T probably damaging Het
Chd6 A G 2: 160,983,103 L1212S probably damaging Het
Clock G C 5: 76,266,802 D15E probably benign Het
Clstn2 A G 9: 97,461,393 V667A probably benign Het
Cr2 A T 1: 195,169,253 probably null Het
Cyp2e1 A G 7: 140,773,079 D343G probably damaging Het
Dync1h1 G A 12: 110,636,509 E2195K probably benign Het
Etf1 G A 18: 34,908,167 T298I possibly damaging Het
Gm5431 T C 11: 48,895,434 probably benign Het
Gss G A 2: 155,567,721 T265I probably damaging Het
Heatr1 C T 13: 12,406,046 S406L possibly damaging Het
Hgsnat C A 8: 25,957,335 M310I possibly damaging Het
Inpp5b G A 4: 124,789,080 R598H probably damaging Het
Ints2 G T 11: 86,249,248 Q253K probably damaging Het
Kng1 A G 16: 23,078,980 M377V probably benign Het
Krt72 C T 15: 101,786,005 probably null Het
Lemd2 G C 17: 27,190,732 R482G probably damaging Het
Lrrc49 A T 9: 60,680,527 H117Q probably damaging Het
Mcm6 A T 1: 128,351,476 F191Y probably damaging Het
Mecom T C 3: 29,979,800 T252A possibly damaging Het
Mgat4e T C 1: 134,541,533 T258A probably benign Het
Mpeg1 A G 19: 12,462,804 N542S probably damaging Het
Nln C T 13: 104,061,753 V184I probably benign Het
Nova1 A C 12: 46,816,893 F91L unknown Het
Polk T C 13: 96,484,208 I516V probably benign Het
Ppig C T 2: 69,749,018 P357S unknown Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Rasal2 A T 1: 157,164,666 H552Q probably damaging Het
Rnf41 G A 10: 128,435,571 E117K probably benign Het
Sbk3 A G 7: 4,967,453 Y306H possibly damaging Het
Senp1 A G 15: 98,076,554 S126P probably benign Het
Sfr1 A G 19: 47,733,690 K182E probably benign Het
Slc25a4 C A 8: 46,209,288 R111L probably damaging Het
Slc9c1 A T 16: 45,573,347 Y551F probably benign Het
Stard4 A T 18: 33,206,210 N80K probably damaging Het
Tbk1 G A 10: 121,571,916 T104M probably damaging Het
Tedc2 T A 17: 24,216,317 E366V probably damaging Het
Tedc2 C A 17: 24,216,318 E366* probably null Het
Tmem102 A T 11: 69,804,370 W259R probably damaging Het
Tnk1 A T 11: 69,853,136 C466S probably benign Het
Tspoap1 A C 11: 87,766,120 Q307P probably damaging Het
Ugt2b35 A G 5: 87,011,530 N528D possibly damaging Het
Usp6nl A G 2: 6,426,998 probably null Het
Vmn1r203 C T 13: 22,524,508 T153M probably benign Het
Vmn1r89 T A 7: 13,220,011 S157T probably damaging Het
Vmn2r103 A T 17: 19,792,968 Y117F probably benign Het
Vmn2r116 A C 17: 23,386,141 M143L probably benign Het
Vmn2r62 A T 7: 42,764,837 D727E probably damaging Het
Vps13c A G 9: 67,955,022 I2974V probably benign Het
Wrn C T 8: 33,268,819 G769D probably damaging Het
Zhx3 T A 2: 160,781,020 H409L possibly damaging Het
Other mutations in Lrpprc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00341:Lrpprc APN 17 84750525 missense possibly damaging 0.91
IGL01319:Lrpprc APN 17 84705412 utr 3 prime probably benign
IGL01380:Lrpprc APN 17 84722730 missense probably benign
IGL01560:Lrpprc APN 17 84708119 missense probably benign 0.07
IGL01582:Lrpprc APN 17 84754543 missense probably null 0.00
IGL01996:Lrpprc APN 17 84773270 missense probably benign
IGL02109:Lrpprc APN 17 84726570 nonsense probably null
IGL02163:Lrpprc APN 17 84753472 missense probably damaging 0.97
IGL02248:Lrpprc APN 17 84771467 missense probably damaging 0.99
IGL02503:Lrpprc APN 17 84726339 missense probably benign
IGL02545:Lrpprc APN 17 84775425 missense probably benign
IGL02570:Lrpprc APN 17 84750553 missense probably damaging 1.00
IGL02636:Lrpprc APN 17 84753104 unclassified probably benign
IGL02943:Lrpprc APN 17 84771450 missense probably benign 0.00
IGL03008:Lrpprc APN 17 84751247 missense probably benign 0.05
R6807_Lrpprc_629 UTSW 17 84749103 missense possibly damaging 0.93
P0023:Lrpprc UTSW 17 84726338 missense probably benign 0.00
R0027:Lrpprc UTSW 17 84767007 nonsense probably null
R0027:Lrpprc UTSW 17 84767007 nonsense probably null
R0302:Lrpprc UTSW 17 84740078 missense possibly damaging 0.76
R0389:Lrpprc UTSW 17 84753112 critical splice donor site probably null
R0448:Lrpprc UTSW 17 84770894 missense probably benign 0.09
R1759:Lrpprc UTSW 17 84740081 missense probably damaging 1.00
R2019:Lrpprc UTSW 17 84752331 missense possibly damaging 0.56
R2169:Lrpprc UTSW 17 84770077 missense probably benign 0.00
R2312:Lrpprc UTSW 17 84773258 missense probably damaging 0.96
R2319:Lrpprc UTSW 17 84726390 missense probably benign
R2568:Lrpprc UTSW 17 84726649 missense probably damaging 1.00
R3013:Lrpprc UTSW 17 84767069 missense probably benign 0.04
R3620:Lrpprc UTSW 17 84770024 missense probably benign 0.01
R3789:Lrpprc UTSW 17 84771528 missense probably benign 0.25
R3848:Lrpprc UTSW 17 84770927 missense probably benign 0.01
R3973:Lrpprc UTSW 17 84770841 critical splice donor site probably null
R4111:Lrpprc UTSW 17 84726338 missense probably benign 0.00
R4164:Lrpprc UTSW 17 84731189 missense possibly damaging 0.47
R4331:Lrpprc UTSW 17 84740542 critical splice donor site probably null
R4531:Lrpprc UTSW 17 84712787 missense probably benign 0.01
R4832:Lrpprc UTSW 17 84707156 missense probably benign 0.24
R4947:Lrpprc UTSW 17 84771538 missense probably benign 0.02
R5134:Lrpprc UTSW 17 84751256 missense probably benign 0.00
R5333:Lrpprc UTSW 17 84790393 missense probably benign 0.01
R5950:Lrpprc UTSW 17 84740170 missense possibly damaging 0.86
R5972:Lrpprc UTSW 17 84712822 missense possibly damaging 0.88
R6185:Lrpprc UTSW 17 84767024 missense probably benign
R6253:Lrpprc UTSW 17 84740637 missense probably benign 0.00
R6488:Lrpprc UTSW 17 84751353 missense probably damaging 1.00
R6807:Lrpprc UTSW 17 84749103 missense possibly damaging 0.93
R6911:Lrpprc UTSW 17 84756283 missense possibly damaging 0.67
R6933:Lrpprc UTSW 17 84722703 missense probably benign 0.42
R6955:Lrpprc UTSW 17 84776989 missense probably damaging 0.98
R7448:Lrpprc UTSW 17 84772139 missense probably damaging 0.99
R7727:Lrpprc UTSW 17 84776947 missense probably benign 0.00
R8003:Lrpprc UTSW 17 84752317 missense probably benign 0.01
R8178:Lrpprc UTSW 17 84772147 missense probably damaging 1.00
R8310:Lrpprc UTSW 17 84773096 missense probably damaging 1.00
R8322:Lrpprc UTSW 17 84740068 critical splice donor site probably null
X0026:Lrpprc UTSW 17 84710662 missense probably benign 0.42
Z1088:Lrpprc UTSW 17 84731784 nonsense probably null
Z1088:Lrpprc UTSW 17 84770500 critical splice acceptor site probably null
Z1176:Lrpprc UTSW 17 84770431 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- GGCCACATGGCATTTCTTTGCTC -3'
(R):5'- AAGACTTCCAGGACTTAGCTTAGCTCA -3'

Sequencing Primer
(F):5'- TGCTCTTGTTTTCACCCTTAAATAC -3'
(R):5'- GGACTTAGCTTAGCTCAGTTTTATAC -3'
Posted On2014-03-17