Incidental Mutation 'R1396:Stard4'
ID162684
Institutional Source Beutler Lab
Gene Symbol Stard4
Ensembl Gene ENSMUSG00000024378
Gene NameStAR-related lipid transfer (START) domain containing 4
Synonyms
MMRRC Submission 039458-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1396 (G1)
Quality Score225
Status Not validated
Chromosome18
Chromosomal Location33199355-33213862 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 33206210 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 80 (N80K)
Ref Sequence ENSEMBL: ENSMUSP00000114109 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025236] [ENSMUST00000118990] [ENSMUST00000119991]
Predicted Effect possibly damaging
Transcript: ENSMUST00000025236
AA Change: N80K

PolyPhen 2 Score 0.859 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000025236
Gene: ENSMUSG00000024378
AA Change: N80K

DomainStartEndE-ValueType
START 25 224 1.43e-11 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000118990
AA Change: N80K

PolyPhen 2 Score 0.934 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000114131
Gene: ENSMUSG00000024378
AA Change: N80K

DomainStartEndE-ValueType
PDB:1JSS|B 1 110 5e-78 PDB
SCOP:d1jssa_ 24 110 3e-17 SMART
Blast:START 25 110 4e-58 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000119991
AA Change: N80K

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000114109
Gene: ENSMUSG00000024378
AA Change: N80K

DomainStartEndE-ValueType
PDB:1JSS|B 1 110 1e-76 PDB
SCOP:d1jssa_ 24 110 8e-17 SMART
Blast:START 25 110 8e-57 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141617
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.3%
  • 20x: 89.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Cholesterol homeostasis is regulated, at least in part, by sterol regulatory element (SRE)-binding proteins (e.g., SREBP1; MIM 184756) and by liver X receptors (e.g., LXRA; MIM 602423). Upon sterol depletion, LXRs are inactive and SREBPs are cleaved, after which they bind promoter SREs and activate genes involved in cholesterol biosynthesis and uptake. Sterol transport is mediated by vesicles or by soluble protein carriers, such as steroidogenic acute regulatory protein (STAR; MIM 600617). STAR is homologous to a family of proteins containing a 200- to 210-amino acid STAR-related lipid transfer (START) domain, including STARD4 (Soccio et al., 2002 [PubMed 12011452]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased liver weight, body weight, and body length. Female mice homozygous for this allele exhibit decreased circulating cholesterol when fed a low cholesterol diet and altered bile composition when fed standard chow. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921530L21Rik A G 14: 95,882,551 N248S probably benign Het
4930486L24Rik G A 13: 60,853,243 P160S probably benign Het
Adamts12 G T 15: 11,311,472 D1272Y probably benign Het
Akr1c20 A T 13: 4,507,727 V267D probably damaging Het
C1s1 A G 6: 124,531,051 S660P probably damaging Het
Ccdc40 A G 11: 119,231,803 T144A possibly damaging Het
Cdk20 T C 13: 64,437,403 I167T probably damaging Het
Chd6 A G 2: 160,983,103 L1212S probably damaging Het
Clock G C 5: 76,266,802 D15E probably benign Het
Clstn2 A G 9: 97,461,393 V667A probably benign Het
Cr2 A T 1: 195,169,253 probably null Het
Cyp2e1 A G 7: 140,773,079 D343G probably damaging Het
Dync1h1 G A 12: 110,636,509 E2195K probably benign Het
Etf1 G A 18: 34,908,167 T298I possibly damaging Het
Gm5431 T C 11: 48,895,434 probably benign Het
Gss G A 2: 155,567,721 T265I probably damaging Het
Heatr1 C T 13: 12,406,046 S406L possibly damaging Het
Hgsnat C A 8: 25,957,335 M310I possibly damaging Het
Inpp5b G A 4: 124,789,080 R598H probably damaging Het
Ints2 G T 11: 86,249,248 Q253K probably damaging Het
Kng1 A G 16: 23,078,980 M377V probably benign Het
Krt72 C T 15: 101,786,005 probably null Het
Lemd2 G C 17: 27,190,732 R482G probably damaging Het
Lrpprc C T 17: 84,726,303 D1049N possibly damaging Het
Lrrc49 A T 9: 60,680,527 H117Q probably damaging Het
Mcm6 A T 1: 128,351,476 F191Y probably damaging Het
Mecom T C 3: 29,979,800 T252A possibly damaging Het
Mgat4e T C 1: 134,541,533 T258A probably benign Het
Mpeg1 A G 19: 12,462,804 N542S probably damaging Het
Nln C T 13: 104,061,753 V184I probably benign Het
Nova1 A C 12: 46,816,893 F91L unknown Het
Polk T C 13: 96,484,208 I516V probably benign Het
Ppig C T 2: 69,749,018 P357S unknown Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Rasal2 A T 1: 157,164,666 H552Q probably damaging Het
Rnf41 G A 10: 128,435,571 E117K probably benign Het
Sbk3 A G 7: 4,967,453 Y306H possibly damaging Het
Senp1 A G 15: 98,076,554 S126P probably benign Het
Sfr1 A G 19: 47,733,690 K182E probably benign Het
Slc25a4 C A 8: 46,209,288 R111L probably damaging Het
Slc9c1 A T 16: 45,573,347 Y551F probably benign Het
Tbk1 G A 10: 121,571,916 T104M probably damaging Het
Tedc2 T A 17: 24,216,317 E366V probably damaging Het
Tedc2 C A 17: 24,216,318 E366* probably null Het
Tmem102 A T 11: 69,804,370 W259R probably damaging Het
Tnk1 A T 11: 69,853,136 C466S probably benign Het
Tspoap1 A C 11: 87,766,120 Q307P probably damaging Het
Ugt2b35 A G 5: 87,011,530 N528D possibly damaging Het
Usp6nl A G 2: 6,426,998 probably null Het
Vmn1r203 C T 13: 22,524,508 T153M probably benign Het
Vmn1r89 T A 7: 13,220,011 S157T probably damaging Het
Vmn2r103 A T 17: 19,792,968 Y117F probably benign Het
Vmn2r116 A C 17: 23,386,141 M143L probably benign Het
Vmn2r62 A T 7: 42,764,837 D727E probably damaging Het
Vps13c A G 9: 67,955,022 I2974V probably benign Het
Wrn C T 8: 33,268,819 G769D probably damaging Het
Zhx3 T A 2: 160,781,020 H409L possibly damaging Het
Other mutations in Stard4
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0462:Stard4 UTSW 18 33205149 missense probably damaging 1.00
R1577:Stard4 UTSW 18 33205098 missense probably damaging 1.00
R5308:Stard4 UTSW 18 33203625 missense probably damaging 1.00
R5481:Stard4 UTSW 18 33205245 missense probably benign 0.03
R6161:Stard4 UTSW 18 33209056 missense probably damaging 0.99
R6393:Stard4 UTSW 18 33205225 missense probably benign 0.00
R7062:Stard4 UTSW 18 33205534 intron probably null
R7478:Stard4 UTSW 18 33205324 missense unknown
X0065:Stard4 UTSW 18 33209072 missense probably damaging 0.98
Z1088:Stard4 UTSW 18 33203717 missense probably benign 0.01
Z1088:Stard4 UTSW 18 33203720 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GCAGCATAGGACACTCCTGAGGTA -3'
(R):5'- CGTTCCTTAAAGCCAGTGTAGTCATGT -3'

Sequencing Primer
(F):5'- CTACTCTCAACCAATGTAATGAATGC -3'
(R):5'- tctaacattacaacaggacaggg -3'
Posted On2014-03-17