Incidental Mutation 'R1396:Mpeg1'
ID162686
Institutional Source Beutler Lab
Gene Symbol Mpeg1
Ensembl Gene ENSMUSG00000046805
Gene Namemacrophage expressed gene 1
SynonymsMPS1, Mpg-1
MMRRC Submission 039458-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.060) question?
Stock #R1396 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location12460779-12465284 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 12462804 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 542 (N542S)
Ref Sequence ENSEMBL: ENSMUSP00000108573 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045521] [ENSMUST00000081035]
Predicted Effect probably benign
Transcript: ENSMUST00000045521
SMART Domains Protein: ENSMUSP00000040229
Gene: ENSMUSG00000039982

DomainStartEndE-ValueType
WWE 5 86 1.38e-38 SMART
WWE 88 163 6.72e-28 SMART
low complexity region 175 192 N/A INTRINSIC
low complexity region 372 386 N/A INTRINSIC
RING 406 464 2.2e-6 SMART
Blast:RING 510 532 3e-7 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000081035
AA Change: N542S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000108573
Gene: ENSMUSG00000046805
AA Change: N542S

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
MACPF 151 350 2.13e-58 SMART
transmembrane domain 661 683 N/A INTRINSIC
low complexity region 685 698 N/A INTRINSIC
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.3%
  • 20x: 89.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921530L21Rik A G 14: 95,882,551 N248S probably benign Het
4930486L24Rik G A 13: 60,853,243 P160S probably benign Het
Adamts12 G T 15: 11,311,472 D1272Y probably benign Het
Akr1c20 A T 13: 4,507,727 V267D probably damaging Het
C1s1 A G 6: 124,531,051 S660P probably damaging Het
Ccdc40 A G 11: 119,231,803 T144A possibly damaging Het
Cdk20 T C 13: 64,437,403 I167T probably damaging Het
Chd6 A G 2: 160,983,103 L1212S probably damaging Het
Clock G C 5: 76,266,802 D15E probably benign Het
Clstn2 A G 9: 97,461,393 V667A probably benign Het
Cr2 A T 1: 195,169,253 probably null Het
Cyp2e1 A G 7: 140,773,079 D343G probably damaging Het
Dync1h1 G A 12: 110,636,509 E2195K probably benign Het
Etf1 G A 18: 34,908,167 T298I possibly damaging Het
Gm5431 T C 11: 48,895,434 probably benign Het
Gss G A 2: 155,567,721 T265I probably damaging Het
Heatr1 C T 13: 12,406,046 S406L possibly damaging Het
Hgsnat C A 8: 25,957,335 M310I possibly damaging Het
Inpp5b G A 4: 124,789,080 R598H probably damaging Het
Ints2 G T 11: 86,249,248 Q253K probably damaging Het
Kng1 A G 16: 23,078,980 M377V probably benign Het
Krt72 C T 15: 101,786,005 probably null Het
Lemd2 G C 17: 27,190,732 R482G probably damaging Het
Lrpprc C T 17: 84,726,303 D1049N possibly damaging Het
Lrrc49 A T 9: 60,680,527 H117Q probably damaging Het
Mcm6 A T 1: 128,351,476 F191Y probably damaging Het
Mecom T C 3: 29,979,800 T252A possibly damaging Het
Mgat4e T C 1: 134,541,533 T258A probably benign Het
Nln C T 13: 104,061,753 V184I probably benign Het
Nova1 A C 12: 46,816,893 F91L unknown Het
Polk T C 13: 96,484,208 I516V probably benign Het
Ppig C T 2: 69,749,018 P357S unknown Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Rasal2 A T 1: 157,164,666 H552Q probably damaging Het
Rnf41 G A 10: 128,435,571 E117K probably benign Het
Sbk3 A G 7: 4,967,453 Y306H possibly damaging Het
Senp1 A G 15: 98,076,554 S126P probably benign Het
Sfr1 A G 19: 47,733,690 K182E probably benign Het
Slc25a4 C A 8: 46,209,288 R111L probably damaging Het
Slc9c1 A T 16: 45,573,347 Y551F probably benign Het
Stard4 A T 18: 33,206,210 N80K probably damaging Het
Tbk1 G A 10: 121,571,916 T104M probably damaging Het
Tedc2 T A 17: 24,216,317 E366V probably damaging Het
Tedc2 C A 17: 24,216,318 E366* probably null Het
Tmem102 A T 11: 69,804,370 W259R probably damaging Het
Tnk1 A T 11: 69,853,136 C466S probably benign Het
Tspoap1 A C 11: 87,766,120 Q307P probably damaging Het
Ugt2b35 A G 5: 87,011,530 N528D possibly damaging Het
Usp6nl A G 2: 6,426,998 probably null Het
Vmn1r203 C T 13: 22,524,508 T153M probably benign Het
Vmn1r89 T A 7: 13,220,011 S157T probably damaging Het
Vmn2r103 A T 17: 19,792,968 Y117F probably benign Het
Vmn2r116 A C 17: 23,386,141 M143L probably benign Het
Vmn2r62 A T 7: 42,764,837 D727E probably damaging Het
Vps13c A G 9: 67,955,022 I2974V probably benign Het
Wrn C T 8: 33,268,819 G769D probably damaging Het
Zhx3 T A 2: 160,781,020 H409L possibly damaging Het
Other mutations in Mpeg1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00095:Mpeg1 APN 19 12462710 missense probably benign 0.39
IGL00902:Mpeg1 APN 19 12461769 missense probably damaging 1.00
IGL01141:Mpeg1 APN 19 12462785 missense probably damaging 1.00
IGL02037:Mpeg1 APN 19 12463296 missense probably benign 0.04
IGL02447:Mpeg1 APN 19 12462792 missense probably damaging 1.00
IGL02448:Mpeg1 APN 19 12462609 missense probably benign
IGL02510:Mpeg1 APN 19 12461424 missense probably damaging 1.00
IGL03068:Mpeg1 APN 19 12462206 missense probably benign 0.01
R0128:Mpeg1 UTSW 19 12461223 missense probably benign 0.00
R0310:Mpeg1 UTSW 19 12461691 missense probably benign 0.00
R0312:Mpeg1 UTSW 19 12462403 missense probably damaging 1.00
R0522:Mpeg1 UTSW 19 12461759 missense probably damaging 0.99
R1356:Mpeg1 UTSW 19 12461325 missense probably damaging 0.98
R1436:Mpeg1 UTSW 19 12462459 missense probably damaging 0.98
R1497:Mpeg1 UTSW 19 12461247 missense probably benign 0.04
R1714:Mpeg1 UTSW 19 12462834 missense probably damaging 1.00
R1846:Mpeg1 UTSW 19 12463122 missense probably benign 0.00
R1856:Mpeg1 UTSW 19 12462356 missense probably benign 0.04
R1933:Mpeg1 UTSW 19 12462647 nonsense probably null
R1959:Mpeg1 UTSW 19 12462911 missense probably damaging 1.00
R1960:Mpeg1 UTSW 19 12462911 missense probably damaging 1.00
R1961:Mpeg1 UTSW 19 12462911 missense probably damaging 1.00
R2240:Mpeg1 UTSW 19 12463038 missense probably damaging 0.98
R2474:Mpeg1 UTSW 19 12462249 missense probably damaging 1.00
R3430:Mpeg1 UTSW 19 12463128 missense probably benign 0.22
R4079:Mpeg1 UTSW 19 12462270 missense probably damaging 0.99
R4245:Mpeg1 UTSW 19 12462908 missense probably damaging 0.99
R4451:Mpeg1 UTSW 19 12463232 nonsense probably null
R4888:Mpeg1 UTSW 19 12463070 missense probably damaging 1.00
R4980:Mpeg1 UTSW 19 12461540 missense probably damaging 1.00
R5071:Mpeg1 UTSW 19 12461181 start codon destroyed probably null 0.02
R5089:Mpeg1 UTSW 19 12462997 missense probably benign 0.00
R5120:Mpeg1 UTSW 19 12461429 nonsense probably null
R5327:Mpeg1 UTSW 19 12461649 missense probably damaging 1.00
R5490:Mpeg1 UTSW 19 12461693 missense probably damaging 0.99
R5725:Mpeg1 UTSW 19 12462636 missense probably benign 0.13
R6147:Mpeg1 UTSW 19 12462894 missense probably damaging 1.00
R6243:Mpeg1 UTSW 19 12462240 missense probably benign 0.26
R6486:Mpeg1 UTSW 19 12462105 missense probably damaging 1.00
R6520:Mpeg1 UTSW 19 12461958 missense probably benign 0.04
R7139:Mpeg1 UTSW 19 12461714 missense probably benign 0.07
R7204:Mpeg1 UTSW 19 12462894 missense probably damaging 1.00
R7310:Mpeg1 UTSW 19 12462251 missense probably damaging 0.99
R7665:Mpeg1 UTSW 19 12463094 missense probably damaging 1.00
R7674:Mpeg1 UTSW 19 12461387 missense probably benign
X0064:Mpeg1 UTSW 19 12461972 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- ATCTGCTCTCCCAGACCCATGAAG -3'
(R):5'- TTGGTGGCAACCTGGCTCATAAG -3'

Sequencing Primer
(F):5'- CCTCAAGATTTTCTGCAAGACAGTG -3'
(R):5'- CAACCTGGCTCATAAGAGGTG -3'
Posted On2014-03-17