Incidental Mutation 'R1393:Anxa5'
List |< first << previous [record 3 of 26] next >> last >|
ID162691
Institutional Source Beutler Lab
Gene Symbol Anxa5
Ensembl Gene ENSMUSG00000027712
Gene Nameannexin A5
SynonymsAnx5, annexin V
MMRRC Submission 039455-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1393 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location36448923-36475894 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 36453509 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 194 (T194I)
Ref Sequence ENSEMBL: ENSMUSP00000029266 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029266] [ENSMUST00000199478]
Predicted Effect probably damaging
Transcript: ENSMUST00000029266
AA Change: T194I

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000029266
Gene: ENSMUSG00000027712
AA Change: T194I

DomainStartEndE-ValueType
ANX 30 82 1.65e-24 SMART
ANX 102 154 4.52e-22 SMART
ANX 186 238 3.54e-15 SMART
ANX 261 313 4.52e-22 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196097
Predicted Effect probably damaging
Transcript: ENSMUST00000199478
AA Change: T99I

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000143650
Gene: ENSMUSG00000027712
AA Change: T99I

DomainStartEndE-ValueType
ANX 30 90 4.8e-5 SMART
ANX 91 137 4.9e-9 SMART
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 95.1%
  • 20x: 88.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the annexin family of calcium-dependent phospholipid binding proteins some of which have been implicated in membrane-related events along exocytotic and endocytotic pathways. Annexin 5 is a phospholipase A2 and protein kinase C inhibitory protein with calcium channel activity and a potential role in cellular signal transduction, inflammation, growth and differentiation. Annexin 5 has also been described as placental anticoagulant protein I, vascular anticoagulant-alpha, endonexin II, lipocortin V, placental protein 4 and anchorin CII. The gene spans 29 kb containing 13 exons, and encodes a single transcript of approximately 1.6 kb and a protein product with a molecular weight of about 35 kDa. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice are viable, fertile, and develop normally. Bone development and maintenance are normal, as are clinical-chemical parameters. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 25 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcf3 A G 16: 20,560,430 N682S probably benign Het
Acta2 G A 19: 34,241,792 R337C probably damaging Het
Atf1 A G 15: 100,232,766 T6A possibly damaging Het
Atg4d T A 9: 21,270,833 Y317N probably damaging Het
Bcl6 A G 16: 23,977,566 V37A probably damaging Het
Bsn T C 9: 108,110,517 probably benign Het
Cd300ld2 G A 11: 115,012,578 probably benign Het
Cdh15 G C 8: 122,857,495 E112Q probably damaging Het
Chad A T 11: 94,565,314 M73L probably benign Het
Copz1 A G 15: 103,294,744 N95S probably benign Het
Cwf19l2 T C 9: 3,456,818 V717A probably benign Het
Dock3 C T 9: 106,911,349 G140R probably damaging Het
Gm14226 A T 2: 155,024,191 S23C probably damaging Het
Gria2 T C 3: 80,707,098 E545G probably damaging Het
Nxpe2 T C 9: 48,326,614 T114A probably damaging Het
Olfr811 A G 10: 129,801,932 F198L probably benign Het
Patj G A 4: 98,424,411 V329I probably benign Het
Ptcd3 T A 6: 71,889,621 T404S probably benign Het
Rasa1 A G 13: 85,223,522 C867R probably damaging Het
Rps24 A G 14: 24,491,762 T6A probably damaging Het
Rsad2 T C 12: 26,456,377 S15G probably damaging Het
Serpina12 T C 12: 104,037,750 I208V possibly damaging Het
Spock1 A T 13: 57,907,454 L45Q probably damaging Het
Stat3 A T 11: 100,888,765 probably null Het
Zfp810 T C 9: 22,280,514 D90G probably benign Het
Other mutations in Anxa5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00505:Anxa5 APN 3 36457497 missense possibly damaging 0.85
IGL02125:Anxa5 APN 3 36452264 missense probably damaging 1.00
IGL02686:Anxa5 APN 3 36449355 missense probably benign 0.19
IGL03268:Anxa5 APN 3 36450679 missense probably benign
R0131:Anxa5 UTSW 3 36450672 missense probably damaging 0.96
R0131:Anxa5 UTSW 3 36450672 missense probably damaging 0.96
R0132:Anxa5 UTSW 3 36450672 missense probably damaging 0.96
R0365:Anxa5 UTSW 3 36457469 missense probably damaging 0.98
R0376:Anxa5 UTSW 3 36460488 missense probably damaging 1.00
R1424:Anxa5 UTSW 3 36452292 splice site probably null
R1626:Anxa5 UTSW 3 36461981 missense probably damaging 1.00
R1778:Anxa5 UTSW 3 36465331 missense probably damaging 0.97
R1873:Anxa5 UTSW 3 36449402 missense probably damaging 1.00
R3861:Anxa5 UTSW 3 36450658 missense probably benign 0.36
R4076:Anxa5 UTSW 3 36450380 missense probably benign
R5871:Anxa5 UTSW 3 36452249 missense possibly damaging 0.94
R6018:Anxa5 UTSW 3 36450658 missense probably benign 0.36
R6056:Anxa5 UTSW 3 36450691 missense probably damaging 0.98
R6081:Anxa5 UTSW 3 36465287 missense probably damaging 1.00
R6522:Anxa5 UTSW 3 36465302 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTCTGACAGTGAAGAGACTGCGAAG -3'
(R):5'- AGCATCTCTCCTGGAAGATGGGAC -3'

Sequencing Primer
(F):5'- CGAAGGACATCTCGTTTGC -3'
(R):5'- GGGACATTCCAGTCAACATTTGC -3'
Posted On2014-03-17